ID: 1103233253

View in Genome Browser
Species Human (GRCh38)
Location 12:119350128-119350150
Sequence GATCTCCCTGGTTCAAGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 79}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103233253 Original CRISPR GATCTCCCTGGTTCAAGATA GGG (reversed) Intronic
900398666 1:2463844-2463866 GTCCTCCCTGGTTCAACACAGGG + Intronic
901657255 1:10776610-10776632 GCTCTCCCTGGTACCAGCTAGGG + Intronic
902180360 1:14683686-14683708 GATCTCCTTGGTACCAGATAGGG - Intronic
913402781 1:118454826-118454848 GGTCTCCCTGATGCAAGAGATGG + Intergenic
921964026 1:221068608-221068630 GATTTCCTTGATTCAAAATAGGG - Intergenic
923713842 1:236408399-236408421 GATCAGCCTGGTCCAACATAGGG - Intronic
923989415 1:239419003-239419025 GATATCCCTGTTTCTAGATGAGG + Intronic
1067352971 10:45493737-45493759 GATTTTTCTGGTTCAAGATTTGG - Intronic
1074418535 10:113288016-113288038 GTTCTCCGTGCTTCAAGATGAGG - Intergenic
1074871000 10:117575985-117576007 GATCTCCTTGGTTCATGGGAAGG - Intergenic
1080696458 11:34606852-34606874 AAGCTCCCTGGTGCTAGATATGG + Intergenic
1084632925 11:70367299-70367321 GTTCTCCCTGGTTTAAGAGCTGG - Intronic
1085742647 11:79090212-79090234 GATTTCCCTGGTGCAGGACAAGG + Intronic
1090448287 11:126783394-126783416 AATATCCCTGCTTCAAAATAAGG + Intronic
1093363462 12:18261723-18261745 GATATCTCTGTTTCAAAATATGG - Intronic
1095127962 12:38504303-38504325 GATCTCTCTGGTCCTAGAAAGGG + Intergenic
1098682776 12:73378850-73378872 GATCTCCCTGCCTCCAGAGATGG + Intergenic
1103233253 12:119350128-119350150 GATCTCCCTGGTTCAAGATAGGG - Intronic
1104252743 12:127110926-127110948 GTTCTTCCTTGTTCTAGATAGGG + Intergenic
1105465694 13:20637557-20637579 GCTGTCCCTGCTCCAAGATAGGG - Intronic
1107774148 13:43820480-43820502 GCTCTCACTGGTCAAAGATAGGG + Intergenic
1202898357 14_GL000194v1_random:22589-22611 GGCATCCCTGGTTCAAGACAAGG - Intergenic
1123434728 15:20246851-20246873 GATCTCACGCGTGCAAGATAAGG + Intergenic
1125062252 15:35438343-35438365 CATGTCCCTGGTTCAAGCGATGG + Intronic
1129060518 15:72857007-72857029 CATCTCCCTTGTTAAAGAGATGG - Intergenic
1130688786 15:86062281-86062303 GATCTCCCTGGTCCAAGCCCAGG + Intergenic
1136538686 16:30915583-30915605 CACCTCCCGGGTTCAAGATGGGG - Intergenic
1137256371 16:46778402-46778424 GCCCTCCCTGGTTGAAGATGGGG - Intronic
1139158582 16:64475301-64475323 CTTCTCCCTGGATCAAGAAATGG - Intergenic
1139284977 16:65804607-65804629 GAGCTGCCTGGTACAAGAAAAGG - Intergenic
1144125435 17:12198404-12198426 GCTCTCCCTGCACCAAGATAAGG - Intergenic
1152444300 17:80332127-80332149 GAGCTCCCAGGTCCAAGAAATGG + Exonic
1153248983 18:3101650-3101672 GAACTCGCTGGTTCAAGTTATGG - Intronic
1156323148 18:36046907-36046929 GATCTTCCTGGTTCTTGATATGG - Intronic
1158392087 18:57052133-57052155 GTTCTACCTGGTTCTAGTTATGG + Intergenic
1158909745 18:62047793-62047815 GATCTTCCTGGTTCTTGATGTGG - Intronic
1161747718 19:6071295-6071317 GAGCTCCCTGGCTCCAGACAAGG + Intronic
1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG + Intronic
929082195 2:38132090-38132112 TTTCTCCCTGGGTCAACATACGG - Intergenic
937737441 2:125309681-125309703 GATCCCCCTCCTTCAAGATTTGG - Intergenic
937741844 2:125363895-125363917 GATAACCCTGGATGAAGATATGG - Intergenic
939896428 2:147797116-147797138 AAGCTCTCTGATTCAAGATATGG + Intergenic
945287049 2:208093397-208093419 AATCTCCCTTGCTAAAGATAAGG - Intergenic
1176618044 21:9038582-9038604 GGCATCCCTGGTTCAAGACAAGG - Intergenic
1178091169 21:29164538-29164560 GGTCTCCCTGGATCAAGTTTGGG + Intronic
1180291036 22:10851737-10851759 GACATCCCTGGTTCAAGACCAGG + Intergenic
1183209122 22:36439576-36439598 CAACTCCCTGGTTCAAGCGATGG - Intergenic
1183750436 22:39717064-39717086 GCACACCCTTGTTCAAGATACGG + Intergenic
954654290 3:52184593-52184615 GATCTCCCTGGTCCACGCTCTGG + Intergenic
954793527 3:53149622-53149644 TCTCTCCCTGCTTCAAGATGAGG - Intergenic
954912139 3:54119688-54119710 GAACTCCCTGGTTCAAAGTGAGG + Intergenic
956177673 3:66488711-66488733 GATCTCCCTGGTAAAAGGGATGG + Intronic
962141146 3:132792082-132792104 GAACTCACTGGTTCACAATAGGG + Intergenic
966442094 3:179957022-179957044 GATCACCTTGATTCAATATAAGG + Intronic
967306950 3:188068508-188068530 TATCTCCCTTGTTCAAGGTGAGG - Intergenic
969118323 4:4888428-4888450 GGTCTCCCTAGTTCAAGAACAGG - Intergenic
975733976 4:77364101-77364123 GATCTCCTTAGTTTAATATAGGG - Intronic
978296681 4:107213441-107213463 GACCTCCCTGAATCAACATAAGG + Intronic
981039136 4:140206145-140206167 CAACTCCCTGGTTCTAGTTATGG - Intergenic
982980133 4:162122899-162122921 TCTTTCCCTGGTTCAAGAGAAGG + Intronic
993565131 5:89464979-89465001 GTTCTCCCTCATTCTAGATAAGG - Intergenic
994640182 5:102398142-102398164 GATATGCCTGGTACAAAATATGG - Intronic
996541035 5:124630170-124630192 AATCTCCCTTGTTCCTGATATGG + Intergenic
996798781 5:127379564-127379586 CATCTCCCTGGTTCTTTATATGG + Intronic
998114351 5:139524732-139524754 GTTCTCCCTGGTTCCAGGAATGG - Intergenic
1004017314 6:11744006-11744028 GATCTCCATTGTTAAAGATGGGG + Intronic
1004307089 6:14510766-14510788 GATTGCTCTGGTTGAAGATAGGG - Intergenic
1004674152 6:17824855-17824877 GTCCACCCTGGTTCAAGTTAGGG + Intronic
1013166362 6:107596395-107596417 TATCTCCCTGGTTCTAGTTCAGG + Intronic
1022966057 7:35473496-35473518 GTACTCCCTGGTTCCAGAGAGGG - Intergenic
1029044051 7:97608625-97608647 GATTCCCCTGGTTGAAAATAAGG - Intergenic
1032728685 7:134616162-134616184 GAGCTCCCTGGGTCAAGAAAAGG + Intergenic
1034118650 7:148607298-148607320 GTTCTCCCTGGTAAAAGACAGGG + Intronic
1037089406 8:14895556-14895578 GATCTTCCAGATTCAAAATAAGG - Intronic
1039398286 8:37246289-37246311 GATTTACCTGGTTCATGTTAAGG + Intergenic
1042955978 8:74251068-74251090 GATCACCCTGATTCAGGAAATGG - Intronic
1051470047 9:17428086-17428108 GATCACCCTTGTTCAAGGAATGG + Intronic
1054900521 9:70364149-70364171 GATCTCCCTCATCAAAGATATGG - Intergenic
1055367612 9:75562125-75562147 TTTCTTCCTGGTTCAATATAGGG + Intergenic
1187282973 X:17876011-17876033 GATTTCCCTGGCTCTTGATATGG + Intergenic
1193289843 X:79759748-79759770 TTTCTTCCTGGTTCAATATAAGG + Intergenic
1196606028 X:117658091-117658113 GCTCTCTCTGGTTCAAGGAAGGG - Intergenic
1198552317 X:137757904-137757926 GATCTCCTTGGTTCCAGGTTAGG - Intergenic
1199488430 X:148372940-148372962 GAGCTCCCTGATAAAAGATAAGG - Intergenic