ID: 1103233827

View in Genome Browser
Species Human (GRCh38)
Location 12:119355128-119355150
Sequence GTTTCAAGACTTTTAAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 344}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103233827_1103233839 26 Left 1103233827 12:119355128-119355150 CCTACTTTTAAAAGTCTTGAAAC 0: 1
1: 0
2: 0
3: 27
4: 344
Right 1103233839 12:119355177-119355199 CCTGAGAGAGGGCTGGCCTGAGG 0: 1
1: 0
2: 5
3: 59
4: 463
1103233827_1103233830 -10 Left 1103233827 12:119355128-119355150 CCTACTTTTAAAAGTCTTGAAAC 0: 1
1: 0
2: 0
3: 27
4: 344
Right 1103233830 12:119355141-119355163 GTCTTGAAACTTGGGTAACCAGG 0: 1
1: 0
2: 0
3: 5
4: 78
1103233827_1103233840 29 Left 1103233827 12:119355128-119355150 CCTACTTTTAAAAGTCTTGAAAC 0: 1
1: 0
2: 0
3: 27
4: 344
Right 1103233840 12:119355180-119355202 GAGAGAGGGCTGGCCTGAGGTGG 0: 1
1: 0
2: 9
3: 71
4: 563
1103233827_1103233835 15 Left 1103233827 12:119355128-119355150 CCTACTTTTAAAAGTCTTGAAAC 0: 1
1: 0
2: 0
3: 27
4: 344
Right 1103233835 12:119355166-119355188 GACTTGGTCTCCCTGAGAGAGGG 0: 1
1: 0
2: 1
3: 30
4: 426
1103233827_1103233834 14 Left 1103233827 12:119355128-119355150 CCTACTTTTAAAAGTCTTGAAAC 0: 1
1: 0
2: 0
3: 27
4: 344
Right 1103233834 12:119355165-119355187 TGACTTGGTCTCCCTGAGAGAGG 0: 1
1: 0
2: 1
3: 27
4: 209
1103233827_1103233836 19 Left 1103233827 12:119355128-119355150 CCTACTTTTAAAAGTCTTGAAAC 0: 1
1: 0
2: 0
3: 27
4: 344
Right 1103233836 12:119355170-119355192 TGGTCTCCCTGAGAGAGGGCTGG 0: 1
1: 0
2: 1
3: 23
4: 289
1103233827_1103233841 30 Left 1103233827 12:119355128-119355150 CCTACTTTTAAAAGTCTTGAAAC 0: 1
1: 0
2: 0
3: 27
4: 344
Right 1103233841 12:119355181-119355203 AGAGAGGGCTGGCCTGAGGTGGG 0: 1
1: 0
2: 4
3: 46
4: 455
1103233827_1103233832 -1 Left 1103233827 12:119355128-119355150 CCTACTTTTAAAAGTCTTGAAAC 0: 1
1: 0
2: 0
3: 27
4: 344
Right 1103233832 12:119355150-119355172 CTTGGGTAACCAGGGTGACTTGG 0: 1
1: 0
2: 0
3: 11
4: 122
1103233827_1103233831 -9 Left 1103233827 12:119355128-119355150 CCTACTTTTAAAAGTCTTGAAAC 0: 1
1: 0
2: 0
3: 27
4: 344
Right 1103233831 12:119355142-119355164 TCTTGAAACTTGGGTAACCAGGG 0: 1
1: 0
2: 0
3: 6
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103233827 Original CRISPR GTTTCAAGACTTTTAAAAGT AGG (reversed) Intronic
901556849 1:10038482-10038504 GTTTCCTGACTTGTAAAATTAGG - Intronic
903479949 1:23645726-23645748 TTTTCAAGATTTAAAAAAGTAGG - Intergenic
908452654 1:64271280-64271302 GTAGCAAAATTTTTAAAAGTCGG + Intergenic
909638967 1:77850560-77850582 GTTTCAAGATTATTACAAGTAGG - Intronic
909881048 1:80879161-80879183 ATTTCCAGATTATTAAAAGTTGG - Intergenic
910007148 1:82411887-82411909 GTTTCAAGTCTTTAAGAAATTGG + Intergenic
910527644 1:88199102-88199124 CTTTCCAGACTTGTAAAAATAGG - Intergenic
910668046 1:89745240-89745262 GCTCCAAGAGCTTTAAAAGTAGG + Intronic
912929330 1:113942361-113942383 ATTTCAAGACTCTTCAAAATGGG - Intronic
913368587 1:118070773-118070795 TTTCCAAGACTTTAAAAAGGTGG - Intronic
918300156 1:183196518-183196540 TTTGCTAGATTTTTAAAAGTGGG + Intronic
918636968 1:186788061-186788083 CTTTAAACACTTTTCAAAGTAGG + Intergenic
918680014 1:187342358-187342380 ATATCAAGATTTTTAAAAATTGG - Intergenic
918855216 1:189745429-189745451 ATTTATATACTTTTAAAAGTTGG + Intergenic
918872326 1:189991553-189991575 GTTTCAATATATTCAAAAGTTGG + Intergenic
921115470 1:212086792-212086814 GTTTCAAATATTTTAAAACTTGG + Intronic
921371374 1:214426472-214426494 GTGTCAAGAGTTATAAAAGATGG - Intronic
921599436 1:217090591-217090613 CTTTAAAGCCTTTTAAAAATGGG + Intronic
921627470 1:217393354-217393376 GTTTAAACATTTTTAAATGTGGG + Intergenic
922869277 1:228887743-228887765 TTGTCATGACTTTGAAAAGTGGG + Intergenic
924211126 1:241768336-241768358 GTTTCAGAACTTTTAAACCTGGG - Intronic
1063788952 10:9418709-9418731 CTTTGAAGTCTTTTAAAAGCTGG + Intergenic
1064863926 10:19857942-19857964 GTTGGGAGACTTTTAAAAATTGG + Intronic
1064889092 10:20148918-20148940 GTTACAGAATTTTTAAAAGTTGG - Intronic
1065743999 10:28822254-28822276 GTTTCTAGACATTGCAAAGTAGG + Intergenic
1065817887 10:29498678-29498700 GTTTAAAAAATTTTAAAAGAAGG + Intronic
1065933761 10:30502234-30502256 ATTTTTAGACTTTTTAAAGTAGG + Intergenic
1066590660 10:36990204-36990226 GTGTCAAGAAGTTGAAAAGTAGG + Intergenic
1068517198 10:58039113-58039135 GTTAATAGACTTTTTAAAGTGGG + Intergenic
1070046323 10:72840603-72840625 TTGTCAAGTCTTTTTAAAGTTGG - Intronic
1070672998 10:78391256-78391278 TTTTCAAGAATTTTACAAGCTGG - Intergenic
1071079664 10:81795720-81795742 GTTTCAAGACATTTGAATATTGG - Intergenic
1073791554 10:106945191-106945213 GTATCTATACTATTAAAAGTAGG - Intronic
1074333230 10:112541659-112541681 GATTCAAGAATTTTAGAAGATGG - Intronic
1074830812 10:117247248-117247270 GTTTAAAGGCTTTTTAAAATTGG + Intronic
1075526130 10:123188668-123188690 GTTTCTTGCCTTTTAATAGTTGG - Intergenic
1075555707 10:123430159-123430181 TTTTCAATACTGTTAAAAATGGG + Intergenic
1075757261 10:124822954-124822976 GTCTCAAAACAGTTAAAAGTTGG + Intronic
1076037976 10:127216754-127216776 GTCTCATGACTTTTCAAGGTTGG + Intronic
1076735081 10:132455368-132455390 GTTTCAAGACTTTTCCACGTGGG - Intergenic
1077887515 11:6396412-6396434 GATCCAAGATTTTAAAAAGTAGG - Intronic
1079284898 11:19119521-19119543 GTGTCAAGACTTTAAAGAGGTGG - Intronic
1079829608 11:25246016-25246038 GTGGAAAGAATTTTAAAAGTTGG + Intergenic
1080363412 11:31543596-31543618 TCTTCAGGACTTTTAAAACTTGG - Intronic
1080944042 11:36951024-36951046 CCTTCAAGAATTGTAAAAGTGGG + Intergenic
1084440437 11:69169757-69169779 GTTTCCAGACTTTTGGAGGTGGG - Intergenic
1085187411 11:74588166-74588188 GTGTCAAGTCTTTTCAAACTAGG - Intronic
1085897646 11:80659223-80659245 GTGTCAAGAAGTTGAAAAGTAGG - Intergenic
1086859095 11:91903317-91903339 GTTTCTTGACTTGTAAAATTGGG - Intergenic
1087106824 11:94417762-94417784 TTTCCCAAACTTTTAAAAGTAGG - Exonic
1087438682 11:98155613-98155635 GTTTCAAGACAATTCAATGTCGG - Intergenic
1087539305 11:99494853-99494875 GTTCTATCACTTTTAAAAGTAGG - Intronic
1088479908 11:110286125-110286147 CTTTTAAGACATTTAAGAGTGGG - Intronic
1089909680 11:122084518-122084540 TTTTCAACACTTTGAGAAGTTGG - Intergenic
1090131230 11:124144584-124144606 ATATCATGACTTTTAAAACTTGG - Intronic
1090175963 11:124649910-124649932 TTTCTAAGACTTTCAAAAGTAGG + Intronic
1091646647 12:2277184-2277206 GTTTCCACACCTTTAAAAGAAGG - Intronic
1091673884 12:2473631-2473653 GTTTCAACATCTTTAAAAGGTGG - Intronic
1091699321 12:2649740-2649762 GTGTCAAGAGTTTGAGAAGTTGG - Intronic
1092095860 12:5841483-5841505 GTTTGCTGACTTATAAAAGTTGG + Intronic
1093893248 12:24548578-24548600 GTTTCACAGCTTTAAAAAGTAGG - Intergenic
1095934529 12:47662760-47662782 GTTTGTAAACTTTTGAAAGTAGG - Exonic
1096696808 12:53354467-53354489 CTTTCAAGAGTTATAAGAGTTGG + Intergenic
1097736360 12:63185946-63185968 ATTTTAAGATTTTTAAAAGAGGG - Intergenic
1099528750 12:83748106-83748128 ATTTCAACAGTTTTAGAAGTAGG - Intergenic
1100316733 12:93451511-93451533 GCTTAAAAACTTTTAAAAATAGG + Intergenic
1101051700 12:100870311-100870333 TTTTGCAGACTTTTAAAAATAGG - Intronic
1101303093 12:103501891-103501913 GTTTCCTGACTTTTAAATGTTGG - Intergenic
1101385160 12:104250831-104250853 GTTTAAACATTTTTACAAGTTGG + Intronic
1102938245 12:116915377-116915399 GCTTAAAAACTTTTAAAAGTGGG - Intronic
1103068232 12:117917870-117917892 GTTACTAGACTTTGAAAATTAGG + Intronic
1103233827 12:119355128-119355150 GTTTCAAGACTTTTAAAAGTAGG - Intronic
1103863040 12:124029496-124029518 GATTTATGACTTTTAAAGGTGGG - Intronic
1107197612 13:37672133-37672155 GCCTCAAGACTTTTAGATGTGGG - Intronic
1107198530 13:37683899-37683921 ATTTCAAGTTATTTAAAAGTAGG - Intronic
1107365662 13:39671259-39671281 GGTTTAAGTATTTTAAAAGTTGG + Intronic
1107858125 13:44635368-44635390 GTGGCAAGAATTTTAAATGTAGG + Intergenic
1109021584 13:57101573-57101595 GTTTAAAGTCTTTCAAAATTTGG - Intergenic
1109170212 13:59086108-59086130 GTTGCAAGCCTTGTAAAACTGGG - Intergenic
1110527487 13:76555833-76555855 TATTGAAGACTTTTACAAGTAGG - Intergenic
1111196989 13:84887924-84887946 GTTTCTATCCTATTAAAAGTCGG - Intergenic
1111249353 13:85583281-85583303 GTTTAAAGAGTTTTGAAAATTGG + Intergenic
1111443713 13:88316317-88316339 GTTTAAATATTTTTAAAATTTGG - Intergenic
1112736572 13:102427173-102427195 GTTTCAAAACTTTCATTAGTTGG - Intergenic
1112809749 13:103203947-103203969 GTTTCAATACTTTCAAAGATGGG + Intergenic
1113210740 13:107977026-107977048 GTTTCAAGAATGTGAAAAGATGG + Intergenic
1114572824 14:23686029-23686051 GTTTGAAGAATTTTGAAACTGGG + Intergenic
1116629501 14:47311885-47311907 ATGTCTAGACTTTTAAAAATGGG - Intronic
1116717592 14:48447513-48447535 GTTTCCTGACTTTTAAATGATGG - Intergenic
1117815035 14:59588844-59588866 GTATCAAAACTTTTAAATATAGG - Intergenic
1118160674 14:63286600-63286622 GTTTCCAAACTATTAAATGTTGG - Intronic
1118376252 14:65179743-65179765 TATATAAGACTTTTAAAAGTGGG - Intergenic
1119653295 14:76398769-76398791 GTTTCAACACTTGTAAAAGGAGG - Intronic
1119838206 14:77770252-77770274 AGTTCCAGACATTTAAAAGTTGG + Intergenic
1120049703 14:79851023-79851045 GTTTTAAAACTCTTACAAGTAGG - Intronic
1120139856 14:80916843-80916865 GTGACAATACTTTTAAAATTTGG - Intronic
1120725689 14:87937560-87937582 GATTCATTACTTTTAAAAATTGG - Intronic
1120732035 14:88014168-88014190 CTTTCCAAACTTTTAAAAGCTGG + Exonic
1122146953 14:99696912-99696934 GCTTTAAGGCTTTTATAAGTGGG + Intronic
1123064116 14:105607450-105607472 CTTTTAAAACTTTAAAAAGTTGG - Intergenic
1123073427 14:105653093-105653115 CTTTTAAAACTTTAAAAAGTTGG - Intergenic
1123093352 14:105751860-105751882 CTTTTAAAACTTTAAAAAGTTGG - Intergenic
1123952509 15:25295293-25295315 TTTTAAAGGATTTTAAAAGTTGG - Intergenic
1125448106 15:39779899-39779921 GTAGCAAGACTTTAAAAAGTGGG + Intronic
1125649615 15:41304797-41304819 GTTTGAGGTCTTTTAAAACTGGG + Intergenic
1127445173 15:59054491-59054513 TTTTCAAGAATTTTAAATGGTGG + Intronic
1129193105 15:73948934-73948956 GATACAACACTTTTAAATGTTGG - Intronic
1129906909 15:79194896-79194918 CATTCAAGACTTTTTAAAGATGG + Intergenic
1130412250 15:83656558-83656580 CTTTCAATACTTTAAAAACTGGG - Intronic
1131877293 15:96823129-96823151 TTTTCAAAACTTTTAAGAGTGGG + Intergenic
1134466312 16:14481567-14481589 GTTCAAAGAGTTTTAACAGTTGG - Intronic
1138824670 16:60304488-60304510 GTTTGAACACATTTAAGAGTAGG + Intergenic
1140697321 16:77548019-77548041 TTTTCAAGACTCGTGAAAGTTGG + Intergenic
1141591548 16:85072668-85072690 CTTCCCAGATTTTTAAAAGTAGG - Intronic
1142847295 17:2688252-2688274 GTTTCAACTTTTTAAAAAGTGGG - Intergenic
1143838109 17:9708971-9708993 GTTTTTACAATTTTAAAAGTGGG + Intronic
1144319112 17:14096338-14096360 GTTTCAAAATTTTTAAATGTAGG + Intronic
1145213429 17:21033566-21033588 GTTTGCACACTTTTAAAAGCTGG - Intronic
1149014368 17:51890969-51890991 CTTTCCAGATTTTTATAAGTAGG + Intronic
1150365550 17:64580634-64580656 CTTCAAAGACTTTTCAAAGTTGG + Intronic
1150667658 17:67157444-67157466 TTTTAAAATCTTTTAAAAGTTGG - Intronic
1150942827 17:69711805-69711827 GCATTATGACTTTTAAAAGTTGG + Intergenic
1151000124 17:70366144-70366166 CTTTAAAAACTTTTAAAAGCGGG + Intergenic
1151697042 17:75723017-75723039 GTTTAGAAAGTTTTAAAAGTAGG - Intronic
1152617472 17:81344624-81344646 GTTTGAAGACTTTCAGAAGTGGG - Intergenic
1153101476 18:1475553-1475575 TTTTATAGACTTATAAAAGTTGG + Intergenic
1153115549 18:1650844-1650866 GCTTCAAGATTTTTAAAGGACGG - Intergenic
1153404016 18:4715205-4715227 GTTTCAAGAAGTTGAACAGTTGG + Intergenic
1153486373 18:5602805-5602827 GTTTAAAGATTTTTAAATATAGG + Intronic
1155324759 18:24654622-24654644 GTTTTAACACATTGAAAAGTTGG - Intergenic
1155522648 18:26684644-26684666 GTTCAAAGACTTTTAAAAAATGG + Intergenic
1155639049 18:27991350-27991372 GTTTGAAGATTTTTAAAAGGTGG - Intronic
1155864194 18:30943746-30943768 GTTTCACTAGTTTTAAAAATTGG - Intergenic
1155891810 18:31279432-31279454 ATGTTAAGACTTTTAAAACTCGG + Intergenic
1157510784 18:48271335-48271357 GATTTGAGACTTTTAAAAATAGG - Intronic
1157747781 18:50151569-50151591 GTTTCATCACTTATAAAATTGGG + Intronic
1158269165 18:55694236-55694258 GTTTTAAAAGTTTTAAATGTTGG - Intergenic
1158495378 18:57950582-57950604 ATTTCACCACTTATAAAAGTAGG + Intergenic
1159985609 18:74837123-74837145 CTTTCAACACATTTAATAGTAGG - Intronic
1164440930 19:28279430-28279452 GTTTCCAGACTTTTAATGCTCGG + Intergenic
1165929738 19:39349353-39349375 GTGTCAAGACATTTAGGAGTGGG + Intronic
1166018098 19:39998588-39998610 CTTTTAAGGCTTTTAGAAGTGGG + Intronic
1167025148 19:46910590-46910612 GTCTCAAAAATTTTAAAAATTGG - Intergenic
926124449 2:10263466-10263488 ATTTCCTGACTTTTAAAAATCGG - Intergenic
926573634 2:14556769-14556791 TGTTCAAGTCTTTTAAAAATTGG - Intergenic
928345031 2:30484456-30484478 GTTTTGAGACTTTTAAATTTTGG + Intronic
930205344 2:48582180-48582202 GTTTCAAGACTTTGTATAATGGG + Exonic
935037050 2:99387285-99387307 GTTTCCAGATGTTTAATAGTTGG + Intronic
935814725 2:106837003-106837025 TTTTCCAGACTTTAAAAACTGGG - Intronic
937419601 2:121742574-121742596 GTGTCAAGAACTTTAAAAATAGG + Intronic
941891590 2:170588020-170588042 GTTTCAAGGCTTTTAAGAAGAGG + Intronic
942412427 2:175724863-175724885 GTTTTAAGATTTTAAAATGTGGG - Intergenic
942663007 2:178286159-178286181 GTTTCCAGATTTTCAAATGTTGG - Intronic
942824871 2:180163603-180163625 GCTTCAACACTTTTGAAAGTGGG + Intergenic
943161934 2:184265517-184265539 GTTTCCAGACTTTTTAATGATGG + Intergenic
943400027 2:187396672-187396694 TTTTGATGACTTTTAAAAATTGG - Intronic
943470528 2:188289533-188289555 GTTTAAAGACTTTAAACAGTGGG + Intergenic
943522364 2:188968808-188968830 TGTTCATGATTTTTAAAAGTGGG + Intergenic
943603562 2:189949935-189949957 ATTTCAGGACACTTAAAAGTAGG - Intronic
943661272 2:190561900-190561922 TTTTAAAAAATTTTAAAAGTTGG - Intergenic
944045816 2:195410594-195410616 GTTGCAAGATTTTTAAAAAAAGG - Intergenic
944649451 2:201814716-201814738 GCTTCAAGGCTTTTTAAAGAGGG - Intronic
945622476 2:212157892-212157914 GTGTCAAGACTGTTAAGAGCAGG - Intronic
945731817 2:213547218-213547240 ATTTCAAGACTATAAAAAGGTGG - Intronic
945835314 2:214832871-214832893 TTTTCAAGACTTTTAAACACTGG - Intergenic
947319851 2:228904927-228904949 GTCTCAAGACTGTTAATAGCTGG - Intronic
948357385 2:237390116-237390138 ATATCAAGACGTTTAAAAGAAGG + Intronic
948496830 2:238356132-238356154 ATTTACAGACTTTTACAAGTTGG + Intronic
1168895837 20:1322897-1322919 GTTTCCAGATTTTTAAATATTGG - Intronic
1169006690 20:2213261-2213283 GTTTCAGAAGTTTTAAAACTGGG + Intergenic
1169952310 20:11058829-11058851 ATTTCAAGATATTTAAAAGGTGG - Intergenic
1170383447 20:15787689-15787711 TTTTAAAGCATTTTAAAAGTTGG - Intronic
1170432486 20:16289375-16289397 GTTTCCAAACATTTAAAAGAGGG - Intronic
1171445480 20:25199976-25199998 ATTTCAACTCTTTTAGAAGTGGG + Intronic
1171476882 20:25417363-25417385 ATCACAACACTTTTAAAAGTAGG + Intronic
1172395705 20:34602957-34602979 GTATCAAAAATTTTAAAAATAGG - Intronic
1173898049 20:46565830-46565852 GTTTCAACACTGTTGATAGTTGG - Intronic
1173919841 20:46735368-46735390 TTTTCAGGATTTTTACAAGTTGG + Exonic
1174825998 20:53769274-53769296 GTTTAAAGATTTTTAAACATAGG - Intergenic
1177739274 21:25134509-25134531 GTGTCAAGGCTTTTCACAGTAGG + Intergenic
1178321112 21:31606379-31606401 CTTTCAATACTTTAAATAGTAGG - Intergenic
1179244684 21:39622147-39622169 GTTTTGAAACTTTCAAAAGTAGG - Intronic
1181749442 22:24978629-24978651 ATTTCACAATTTTTAAAAGTGGG - Intronic
1181898918 22:26136438-26136460 GCTTCCAGACTTTTAAAAAAAGG - Intergenic
1182837318 22:33353252-33353274 GTTTAAAGTCTTGTGAAAGTCGG + Intronic
1182946404 22:34326828-34326850 ATTTCTAGACTTTTAATAATGGG + Intergenic
1183789901 22:40058343-40058365 GTTTGAAAACTTTAAAAAGGGGG + Intronic
1183903582 22:41023248-41023270 TTTAGAAAACTTTTAAAAGTCGG + Intergenic
949114416 3:302410-302432 GTTTCCTGACTTTTTAAAGATGG + Intronic
949250004 3:1972638-1972660 GTTTCAACACTGGAAAAAGTCGG + Intergenic
951647924 3:24914333-24914355 GTTTCAAAGCTTTTAAAGGTGGG + Intergenic
952038038 3:29227367-29227389 CTTGCCAGATTTTTAAAAGTAGG - Intergenic
952867770 3:37866252-37866274 TTTTCAAGACATTTTAAAGCAGG + Intronic
952995652 3:38879582-38879604 TTTTCAAGACTTCTCAAAGCTGG - Intronic
953132166 3:40150569-40150591 GTTTCAGGGCATTTAATAGTAGG - Intronic
953247222 3:41205400-41205422 ATTTCCAGATTTTGAAAAGTGGG + Intronic
953595822 3:44312690-44312712 ATTTCAAGACTTTTTTATGTTGG - Intronic
953675095 3:44994905-44994927 GTTTTAAGCCATTTAAAAATAGG + Intronic
956070292 3:65442207-65442229 GGTTTTAGACTTTTAAAAATGGG + Intronic
957837296 3:85612636-85612658 TTTTCAAAAGTTTTAAAATTTGG - Intronic
958544000 3:95517037-95517059 GATTCAACACATTTCAAAGTGGG - Intergenic
958687130 3:97413214-97413236 GTTTACAGGCTTTCAAAAGTAGG - Intronic
958994069 3:100881108-100881130 ATTTGAAGCCTTTTGAAAGTAGG - Intronic
959491732 3:106998130-106998152 GTTTCCAGAATTTAAAAAATAGG - Intergenic
960060814 3:113318208-113318230 GTTTAAAAACTTTAAAAATTTGG - Intronic
960136333 3:114109268-114109290 ATTTCAAATCTTTTAAAAGAAGG - Intergenic
963029716 3:140957213-140957235 ATTTCAAAACTATTAAAATTAGG + Intronic
963234159 3:142939341-142939363 GTTTCAATATAATTAAAAGTTGG + Intergenic
963917500 3:150872492-150872514 GTTTAAAGACATTTTAAGGTTGG + Intronic
963999871 3:151757439-151757461 GTTACAAGACTTCGAAATGTTGG + Exonic
964243934 3:154628904-154628926 GTTTCTTGACTCTTACAAGTTGG - Intergenic
964366817 3:155959155-155959177 GTTTCTTGACTTTTAATATTGGG + Intergenic
964446501 3:156764701-156764723 GTTTCAAGAATCTTTGAAGTTGG - Intergenic
964570151 3:158102343-158102365 TTTTTAAGCCTTATAAAAGTAGG + Intronic
965270504 3:166612105-166612127 GTTTAATGACTTTTAAAAATGGG + Intergenic
965895756 3:173573235-173573257 GTTTTCTGACTTGTAAAAGTAGG + Intronic
967522482 3:190450037-190450059 TTGTCAAGGCCTTTAAAAGTAGG + Intergenic
968252653 3:197235597-197235619 TTTTAAAGCTTTTTAAAAGTTGG - Intronic
970295159 4:14621651-14621673 CTTTAAGGACTTTTAAAATTTGG - Intergenic
972004891 4:34088703-34088725 GATTAAACAGTTTTAAAAGTTGG - Intergenic
972216968 4:36908544-36908566 GTTTAAAAACTAATAAAAGTAGG + Intergenic
972614914 4:40688754-40688776 GTCTCAAGTCTTTTTAATGTGGG + Intergenic
972821439 4:42706261-42706283 TATTCAATACTTTTAAAACTTGG + Intergenic
973892994 4:55386588-55386610 ATTTCCTGATTTTTAAAAGTTGG - Intergenic
974655543 4:64815026-64815048 GTTTCCAAACTTTTGAATGTAGG - Intergenic
975138773 4:70899818-70899840 ATTTCAATTCTTTGAAAAGTTGG + Intergenic
975162466 4:71139462-71139484 CTTTCTAGGCTTCTAAAAGTTGG - Intergenic
976065047 4:81177291-81177313 GTTTCCAAACTTTTATAACTTGG + Intronic
976658022 4:87510019-87510041 ATTTCAAGACTTTTTTGAGTTGG + Intronic
976929473 4:90547599-90547621 CTTTCAAAAACTTTAAAAGTTGG + Intronic
977959109 4:103064903-103064925 GATTCCAGGCATTTAAAAGTTGG + Intronic
978261381 4:106764435-106764457 GTTTCAATACCTTTAATATTGGG + Intergenic
979630049 4:122890711-122890733 GGTTCAAGTCTTTTTAATGTGGG + Intronic
979722218 4:123914525-123914547 CTTTCTAGACTTTTACAAGGGGG - Intergenic
980455505 4:133035984-133036006 CTTTCAAAACATTTATAAGTAGG + Intergenic
980494454 4:133573264-133573286 GTTGCAACACTTTCAAAAGTAGG + Intergenic
980944235 4:139302939-139302961 AATTTAAGACTTTTAAAATTTGG + Intronic
981601762 4:146497050-146497072 GTTTCATAATTTTTAAAAGAAGG + Intronic
982078148 4:151759885-151759907 GTTTCCAAACTTTAAAAAGAAGG - Intronic
983294286 4:165846359-165846381 GTTTTATGTATTTTAAAAGTTGG + Intergenic
984645497 4:182215174-182215196 TTTTCAAGAGCTTTAATAGTGGG + Intronic
984673497 4:182519282-182519304 TTTTAAAAACTTTTAAATGTGGG + Intronic
986231921 5:5873063-5873085 GTTTCAATAATTTTATAAGAAGG - Intergenic
986522733 5:8638760-8638782 GACTCAAGACATTTAAAAATAGG - Intergenic
988284828 5:29199068-29199090 GTTTCAATTATTTTAAAATTAGG - Intergenic
988314513 5:29606125-29606147 GTCTGAAAACTTTTCAAAGTTGG - Intergenic
988395746 5:30695995-30696017 GATTCAAGATTCTTAACAGTTGG - Intergenic
988526577 5:31992510-31992532 TTTTAAATACTTTTAGAAGTAGG - Intronic
988856337 5:35231197-35231219 GTTTCAGCACTGTTAAATGTGGG - Intergenic
990047482 5:51451225-51451247 GTTAGAAGACTTTTAAAAGGAGG + Intergenic
990719942 5:58683232-58683254 GCTTTAAAACTTATAAAAGTGGG - Intronic
991463222 5:66881559-66881581 TTTTAAAGACTTTAAAAAATCGG + Intronic
991591216 5:68253379-68253401 GGTTCCAGCCTTTTAAAACTAGG + Intronic
991595329 5:68298796-68298818 GTTTTAAGACTCTTAAAATACGG + Exonic
992329686 5:75703325-75703347 GTTTTAATACTATTAAAATTCGG + Intronic
992599847 5:78388250-78388272 TTTTCAAATCTTTTAATAGTAGG - Intronic
993005251 5:82422710-82422732 GTTTCAGGACTGACAAAAGTGGG + Intergenic
994865981 5:105270778-105270800 GTTTAATGCCTTTTAAAAATTGG - Intergenic
994932731 5:106209581-106209603 ATCTCAAGACTTTTAAAAATTGG - Intergenic
996097397 5:119413369-119413391 ATTTCAAGCCTTTTAAATATAGG - Intergenic
996097810 5:119417377-119417399 ATTTCAAGCCTTTTAAATATAGG - Intergenic
998336040 5:141373007-141373029 GTTTCAAGACTATCAAAAGGAGG - Intronic
998642729 5:144029764-144029786 GTTTTAATACTTTGAAGAGTAGG - Intergenic
999923389 5:156347419-156347441 ATTTAAAGACATTTAAAAGATGG + Intronic
1000042527 5:157495399-157495421 GATTCAAGATTTTAAAAAATAGG + Intronic
1000650073 5:163806685-163806707 GTTTCAGGATTTTTAAAGTTTGG - Intergenic
1000691075 5:164321456-164321478 GTGTCACTTCTTTTAAAAGTGGG - Intergenic
1000755233 5:165150086-165150108 CTTTGTAGACTTTTCAAAGTAGG + Intergenic
1000838949 5:166191987-166192009 TTTTTAAGACTTTTCAAAGTTGG + Intergenic
1001338180 5:170818601-170818623 GCTTCAAAACTTCTAAAATTTGG - Intergenic
1001351369 5:170969728-170969750 GTTTCAAAACTTTTAATATAAGG + Intronic
1001498670 5:172210462-172210484 ATTTGGAGCCTTTTAAAAGTTGG - Exonic
1001741233 5:174054552-174054574 TTTTAAAGACTTTTAATAGACGG + Intronic
1003860141 6:10315427-10315449 CTTTCAAGACCTTTGAAATTTGG - Intergenic
1004846468 6:19648424-19648446 GTTTCATCACTTTTAAAAACAGG + Intergenic
1005284185 6:24307068-24307090 ATTTCTAGACCTATAAAAGTAGG + Intronic
1006201109 6:32291916-32291938 GTTTCAAAACTTTTGAAACTAGG - Intronic
1006555960 6:34867004-34867026 GTTTACAGACTTTTAAAAATGGG + Intronic
1006882656 6:37353751-37353773 GTTTAAAGTTGTTTAAAAGTGGG + Intergenic
1007184416 6:39956295-39956317 GTTTTTAGACTTTTACAATTGGG - Intergenic
1009493864 6:64326468-64326490 GCTTTAAGATGTTTAAAAGTAGG + Intronic
1009589047 6:65642480-65642502 GCCTCCAGACTTTTAAAATTGGG + Intronic
1010174283 6:73008851-73008873 GTCTCAACAATTTTAAAAGATGG + Intronic
1011205179 6:84885672-84885694 GTTCTAAGATTTTTAAAATTTGG + Intergenic
1011692212 6:89880636-89880658 TTTTCAAGAATTTAAAAAGAGGG - Intergenic
1012186319 6:96221455-96221477 GTTTCCTGACTTTTTAAAGATGG - Intergenic
1012951360 6:105521443-105521465 TTTGCAAAATTTTTAAAAGTCGG - Intergenic
1013020736 6:106214430-106214452 TTGTCAAGACTATTAAAAGTGGG - Intronic
1013794750 6:113874361-113874383 ATTTATAGACTTTTAAAAGATGG - Intergenic
1014332980 6:120094556-120094578 GTTTTAAGAATTTTAGCAGTAGG - Intergenic
1014488145 6:122026473-122026495 GATTCTTGACTTTTAAAAGTAGG - Intergenic
1015589440 6:134808712-134808734 GTACCAAGACTTTTCAAAGTTGG - Intergenic
1017067685 6:150544604-150544626 AATTCAAGACTTGTAAAAGGAGG + Intergenic
1017697798 6:157035988-157036010 GTTTTAAACCTTTTAAAACTAGG - Intronic
1017976249 6:159359930-159359952 TTTTCAAAATTTTTAAATGTTGG + Intergenic
1018772251 6:166981435-166981457 TTTTCAAGAATTTTATGAGTTGG - Intergenic
1019151598 6:170009934-170009956 CTATCAAAAATTTTAAAAGTCGG - Intergenic
1020731036 7:11880676-11880698 TTTTCAAAACATTTAAAATTTGG + Intergenic
1020862154 7:13507320-13507342 ATTTCAAGACTATTAATAGACGG - Intergenic
1022689984 7:32639867-32639889 GTTGCAAAATATTTAAAAGTAGG + Intergenic
1022714472 7:32886372-32886394 GTTTCAAAACTTTTATGTGTTGG - Intronic
1022917577 7:34974103-34974125 GTTGCAAAATATTTAAAAGTAGG + Intronic
1023640563 7:42252842-42252864 CTATCAAGACTTTTAAAAGATGG - Intergenic
1023901134 7:44480165-44480187 GGTTCAAGAATTTTAAAATAGGG + Intronic
1026627320 7:72007097-72007119 GGTCCAAGAATTTTAAAAATTGG - Intronic
1027981456 7:85229171-85229193 GTTTCAAGATTTCTAAAATATGG - Intergenic
1028578020 7:92374574-92374596 CTTTCAAGAATTTTAAAACAAGG + Intronic
1028930737 7:96410050-96410072 TTTTAAAGACTTTTATATGTTGG + Intergenic
1031184077 7:118453934-118453956 CTTTAAATACTTTTTAAAGTGGG + Intergenic
1031433786 7:121707756-121707778 GTTTCAAATTTTTAAAAAGTTGG - Intergenic
1031831125 7:126627019-126627041 GTTTTAAGACTTATAAGAGAAGG - Intronic
1031885557 7:127242690-127242712 ATTTTAAGACTTTTTAAGGTAGG - Exonic
1032680093 7:134173634-134173656 GTTTCACCATTTTAAAAAGTAGG - Intronic
1032910725 7:136426637-136426659 GTTTTAACACTTTTAGATGTAGG - Intergenic
1033057411 7:138071395-138071417 GTTTGAATACTATTAAAACTGGG + Intronic
1033437272 7:141344511-141344533 ATTTTAAGACTTTTTAAAGCTGG + Intronic
1033540498 7:142351478-142351500 GTTCTAATACTTTTAATAGTCGG - Intergenic
1034218357 7:149424786-149424808 GTTTCAAGACTCTGAAGAGCTGG + Intergenic
1034565885 7:151915485-151915507 GTTTCAAGAGTTTAGAAGGTTGG + Intergenic
1035488468 7:159251024-159251046 CTTACAAGAATTTTAAAAGCAGG - Intergenic
1036178358 8:6561580-6561602 ATGTAAAGTCTTTTAAAAGTTGG - Intronic
1038100429 8:24367700-24367722 ATTTCAAGTATTCTAAAAGTAGG - Intergenic
1038539182 8:28377476-28377498 ATTTAAAGACATTTTAAAGTGGG - Intronic
1038996248 8:32926794-32926816 GTTTAAAGCTATTTAAAAGTTGG - Intergenic
1039741010 8:40382505-40382527 GTTTCTAGATTTAAAAAAGTAGG - Intergenic
1039745678 8:40424157-40424179 GTTTCAACACATTTAAATCTTGG - Intergenic
1045434822 8:102151882-102151904 GTTAAAATACTTTTAAAAGTGGG - Intergenic
1045520034 8:102895477-102895499 GTTTCATGAATTGTAAAAGGGGG + Intronic
1045720060 8:105098658-105098680 GTTTCAACATTTGTAAAAGGGGG - Intronic
1046158055 8:110319809-110319831 GTTACAAGAATTTGGAAAGTAGG - Intergenic
1047393243 8:124471420-124471442 CTTTCAAAACTTTTACAGGTAGG - Intergenic
1048178754 8:132176418-132176440 GTTTCAAGATTTATCATAGTAGG + Intronic
1048747798 8:137634624-137634646 GTTTCAAAAATTATATAAGTTGG + Intergenic
1050243806 9:3666527-3666549 GTTTAAAAACTTTAAAAAATGGG + Intergenic
1051076934 9:13250257-13250279 GTTACAATTCTTATAAAAGTAGG + Intronic
1051562458 9:18457080-18457102 GTTTAAAGATTTTGAAATGTGGG - Intergenic
1051615819 9:19005505-19005527 GTATCAAGACTATTCAATGTGGG + Intronic
1051730193 9:20133712-20133734 GTTTTATGGCTTTTAAGAGTTGG - Intergenic
1051736091 9:20200590-20200612 GTTGCAAAATTTATAAAAGTAGG - Intergenic
1052089662 9:24313004-24313026 GTTTAAAGACTTCTAGAAATAGG + Intergenic
1052199356 9:25758903-25758925 GGTTGAAGACTTTTCAAATTTGG + Intergenic
1052212102 9:25916817-25916839 TTATCATGATTTTTAAAAGTTGG + Intergenic
1053838238 9:42163994-42164016 GTTTCCAGGTTTTTAAAATTGGG + Intergenic
1054095183 9:60894119-60894141 GTTTCCAGGTTTTTAAAATTGGG + Intergenic
1054116652 9:61170044-61170066 GTTTCCAGGTTTTTAAAATTGGG + Intergenic
1054591105 9:67012517-67012539 GTTTCCAGGTTTTTAAAATTGGG - Intergenic
1057166366 9:92929992-92930014 GTTTTAAGACATTTAATAGCAGG - Intergenic
1057479229 9:95431162-95431184 GTTTGAAGACCTTTAAAATAAGG + Intergenic
1058858779 9:109093610-109093632 TTTTCAAAACTCTTTAAAGTAGG + Intronic
1059083206 9:111272165-111272187 TTTTTAAGACTTTTACAATTTGG - Intergenic
1059949221 9:119444539-119444561 GTTTCAAAACATTTTAAAGGTGG + Intergenic
1060099178 9:120823112-120823134 GTCTCAAGAATTTTAATAATTGG + Intronic
1061336087 9:129937430-129937452 CTTTTAAGAATTTTTAAAGTTGG + Intronic
1061545719 9:131302971-131302993 GGTGCAAGACTTTCAAAAGCAGG + Intronic
1186226873 X:7408388-7408410 GGTACAACATTTTTAAAAGTGGG + Intergenic
1186840861 X:13483704-13483726 GTTTTAAGAACTCTAAAAGTAGG + Intergenic
1188757641 X:33983845-33983867 GTTTAAAGACTTTGAAAGTTGGG - Intergenic
1189117277 X:38356233-38356255 GTTTCCAGATCTTTAATAGTAGG + Intronic
1191152358 X:57233524-57233546 GTTCCAAGACTTTTAGAACAAGG + Intergenic
1192576762 X:72248938-72248960 GTTTGAGGACTTGCAAAAGTAGG + Intronic
1193287431 X:79729296-79729318 GTTTAGAGACTATTTAAAGTTGG + Intergenic
1193340835 X:80347343-80347365 GTTTCCAGACTTTTTAATGATGG + Intronic
1194689840 X:96970249-96970271 GTTTCAAAACATTGAAGAGTAGG - Intronic
1194826259 X:98566444-98566466 GATCAAAGACTTTTAAAAATGGG - Intergenic
1194831538 X:98629474-98629496 GTTTCTAAACATTGAAAAGTAGG - Intergenic
1195059772 X:101182994-101183016 GGTTCTAGACTTTTAATTGTGGG + Intergenic
1195967542 X:110442324-110442346 ATTTCCTGACTTTTAAATGTTGG + Intronic
1197278341 X:124506038-124506060 TAATCAAGACTTTTAAATGTTGG - Intronic
1199166609 X:144683250-144683272 ATTTCAGGACTTTTAAAAGGGGG - Intergenic
1199528862 X:148824737-148824759 GTTTCAAAACAATTATAAGTTGG + Intronic
1199910064 X:152277029-152277051 TTTTTAAGATTTTAAAAAGTTGG + Intronic
1200076917 X:153555721-153555743 GTTACAAAATTGTTAAAAGTTGG - Intronic