ID: 1103235346

View in Genome Browser
Species Human (GRCh38)
Location 12:119368066-119368088
Sequence AAGAACAAGAAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4118
Summary {0: 1, 1: 5, 2: 108, 3: 730, 4: 3274}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103235346 Original CRISPR AAGAACAAGAAGAAGGAGGA GGG Intronic
Too many off-targets to display for this crispr