ID: 1103235810

View in Genome Browser
Species Human (GRCh38)
Location 12:119371598-119371620
Sequence CCTGAGGTTTTCCCATTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103235803_1103235810 25 Left 1103235803 12:119371550-119371572 CCGCTTAAAAGCCATCAAATCTT 0: 1
1: 1
2: 7
3: 103
4: 880
Right 1103235810 12:119371598-119371620 CCTGAGGTTTTCCCATTGGTGGG 0: 1
1: 0
2: 1
3: 13
4: 124
1103235805_1103235810 14 Left 1103235805 12:119371561-119371583 CCATCAAATCTTGGTCAAGACAC 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1103235810 12:119371598-119371620 CCTGAGGTTTTCCCATTGGTGGG 0: 1
1: 0
2: 1
3: 13
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103235810 Original CRISPR CCTGAGGTTTTCCCATTGGT GGG Intronic
900499296 1:2992554-2992576 CTTGTGGTTTTCTCATTGGTCGG + Intergenic
902241918 1:15095187-15095209 CGTGAGGTTCCCGCATTGGTTGG - Intronic
903235415 1:21947307-21947329 AATGAGGTTTTCCCATTGGTTGG - Intergenic
904553078 1:31337516-31337538 CCTGAAGTTTACCCATAGGGTGG + Intronic
907961389 1:59285660-59285682 CCCTAGGTTTTCCAATTTGTTGG - Intergenic
909412363 1:75369872-75369894 CTGGAAGTTTTCCCATTGCTTGG + Intronic
912520986 1:110244515-110244537 CCTGAGGTTCTGCCATGGGCTGG + Intronic
913569012 1:120101962-120101984 CCTCTAGTTTTCCCATTAGTTGG + Intergenic
914289821 1:146262953-146262975 CCTCTAGTTTTCCCATTAGTTGG + Intergenic
914550864 1:148713736-148713758 CCTCTAGTTTTCCCATTAGTTGG + Intergenic
918459801 1:184764962-184764984 CCTGAGGTCTTGCCAGTGATAGG + Intergenic
918655553 1:187021665-187021687 CTTGGGTTTTTCTCATTGGTAGG - Intergenic
919113980 1:193258050-193258072 CCTGAGCAGTTCCCAATGGTGGG + Intergenic
919499645 1:198321054-198321076 CATGAGGTTTTCACGTTGGCAGG - Exonic
921929946 1:220747043-220747065 CCTGAGGTTTTTTCCTGGGTGGG + Intergenic
1067918172 10:50423158-50423180 CCTGTGGCTTTCCCGTTGCTGGG - Intronic
1068057318 10:52027141-52027163 TCTGCGTTTTTCCCATTGGCTGG + Intronic
1068325380 10:55478861-55478883 CCCTAGGTTTTCCAATTTGTTGG - Intronic
1069119142 10:64546910-64546932 ACTGTGGTTTTCCCATTGCACGG + Intergenic
1070484985 10:76921815-76921837 ACTGAGGTTTTTCCTTTGGCTGG - Intronic
1071582817 10:86789001-86789023 CCTGAGGTTTTCCCACTACAAGG - Intronic
1074400696 10:113139177-113139199 CCAGAAGTTTTCTCTTTGGTTGG - Intronic
1074529484 10:114287490-114287512 CCTGGAGTTCTCCCCTTGGTAGG + Intronic
1075021994 10:118959008-118959030 CCTGAGGTTATCCCACAGGGAGG - Intergenic
1076422183 10:130339229-130339251 CCTGAGGATTTCCGAGGGGTTGG + Intergenic
1077724807 11:4663511-4663533 CCTGAAACTTTCTCATTGGTGGG - Intergenic
1082012761 11:47461506-47461528 CCCAAGGTTTTTCCATTAGTGGG - Intergenic
1082139366 11:48590072-48590094 GCTGAGGTCTTCCTACTGGTGGG + Intergenic
1086105722 11:83144684-83144706 CCTTAGGCTTTCTCAGTGGTAGG - Intergenic
1086585003 11:88441396-88441418 CCTGTGAATTTTCCATTGGTGGG - Intergenic
1086952806 11:92908462-92908484 CCTGAGGTTGTCCCTTTTCTGGG - Intergenic
1090862260 11:130664646-130664668 CCTGAGGCTTTCTCATGGGCAGG - Intergenic
1093340159 12:17964210-17964232 CCTGGGCTTTTTTCATTGGTAGG + Intergenic
1095563005 12:43587768-43587790 CCTGATGTTTTCCCCATGATGGG + Intergenic
1096940300 12:55336727-55336749 CCTGGGCTTTTTTCATTGGTAGG + Intergenic
1097893989 12:64806074-64806096 CCACTGGTCTTCCCATTGGTGGG - Intronic
1099091546 12:78316403-78316425 CCTGAGCTTGTCCCTTTGGGAGG + Intergenic
1100901512 12:99246363-99246385 CTTGATGTTTTCTCATTGGAAGG + Exonic
1102254711 12:111408792-111408814 CATGAGGGTCTCCCATTGCTGGG + Intronic
1103198246 12:119065232-119065254 CCTTTGGTTCTCACATTGGTTGG + Intronic
1103235810 12:119371598-119371620 CCTGAGGTTTTCCCATTGGTGGG + Intronic
1113860263 13:113478969-113478991 CCTGTGGTTTTCCCAAATGTGGG - Intronic
1116741628 14:48762577-48762599 CCTGAGGTTTTCACACTGGGTGG + Intergenic
1117101175 14:52349855-52349877 TCAGGGGTTTTCCCCTTGGTTGG - Intergenic
1124828155 15:33120517-33120539 CATGAGGTTTTCTCATTTTTTGG - Intronic
1131362654 15:91806888-91806910 GCTGAGATTTTCTCATTGGATGG - Intergenic
1131597854 15:93816670-93816692 CCTGGGCTTTTCTGATTGGTAGG - Intergenic
1133465778 16:6025655-6025677 CCACAGATTCTCCCATTGGTAGG + Intronic
1134452990 16:14374710-14374732 CCTGGGGTTCTCCCAGTAGTCGG + Intergenic
1138258674 16:55596176-55596198 CCTGAGTTTTTCTGGTTGGTAGG - Intergenic
1138986116 16:62330754-62330776 CCAGAGGGATTCCCATTGGTAGG + Intergenic
1139960621 16:70715405-70715427 ACTGCGGTGTTCCCACTGGTGGG + Intronic
1146227479 17:31079432-31079454 CCTGAGGTAGTCCACTTGGTAGG + Intergenic
1148101298 17:45093483-45093505 CCTGAGGTTTTGCCATGAATTGG + Intronic
1155834675 18:30566424-30566446 CCTGTGCTTTTTCAATTGGTAGG + Intergenic
1158847136 18:61456328-61456350 TCTGAGGTTTTCCCATACCTAGG + Intronic
1159281150 18:66287938-66287960 CCTGATGTTTTCCCACGGGAAGG - Intergenic
925409083 2:3628461-3628483 CCTGGGCTGTCCCCATTGGTGGG + Intronic
929341222 2:40820511-40820533 ACTGAGGTTTTCCCTCTAGTGGG + Intergenic
932570897 2:72937892-72937914 CCTGAGCTCTTCCCATTTGCTGG + Intergenic
933028961 2:77301416-77301438 CATGAGGTTTTCCATTTGGATGG + Intronic
938111720 2:128572287-128572309 CGTCAGGTCTTCCCATTGGTTGG + Intergenic
939116331 2:138065615-138065637 CTTGAAGTTGTCCCATTGTTAGG + Intergenic
941500413 2:166267820-166267842 CATTAGGTTTTCCAATTTGTTGG + Intronic
941537095 2:166737767-166737789 CTTTAGGTTTTCCAATTTGTTGG + Intergenic
941832215 2:169974427-169974449 TTTCAGGTTTTCCAATTGGTTGG + Intronic
941927752 2:170913240-170913262 AGTGAGGTTTTCCCATTGGGTGG - Intergenic
942609825 2:177731791-177731813 TCTCAGCTTTTCCCATTGCTAGG + Intronic
946843805 2:223841465-223841487 CCTGGGGTTTTGCTATTTGTGGG - Intergenic
947390516 2:229634872-229634894 CCTGAAGGGTTTCCATTGGTGGG - Intronic
948368369 2:237473086-237473108 CCGGTGGTGTTCCCAGTGGTAGG - Intergenic
948674561 2:239589302-239589324 CCTCAGGTTTTCCCCTTGGGAGG + Intergenic
1171375335 20:24689967-24689989 CCTGAGGTGTTACCTTAGGTTGG + Intergenic
1177319708 21:19505179-19505201 CCTTAGGTTTTCCAATTTATTGG + Intergenic
1178152170 21:29807933-29807955 CCTGAGGTCTTCTCATTGAGGGG + Intronic
1179533348 21:42035020-42035042 CATCATGTTTTCCCATTGCTGGG - Intergenic
1179723098 21:43326629-43326651 CCTGACCTTGTCCCACTGGTAGG - Intergenic
1182740039 22:32561041-32561063 CCGCAGGCTTTCCCATTTGTGGG - Intronic
1183630388 22:39029112-39029134 GTTGAGGGTGTCCCATTGGTAGG + Intronic
1183633849 22:39049198-39049220 GTTGAGGGTGTCCCATTGGTAGG + Intronic
953148822 3:40305547-40305569 CCTGGGGTCTTCCCAATTGTGGG + Intergenic
956664331 3:71627960-71627982 CCAGAAGTTTTCCGATTAGTTGG - Intergenic
957031567 3:75248172-75248194 CCTGAGGTTTTTATCTTGGTTGG - Intergenic
958580086 3:96007374-96007396 ACTGAGGTCCTCCCATGGGTGGG - Intergenic
959955023 3:112227056-112227078 CCCCAGGTTTTCCAATTTGTTGG - Intronic
963012412 3:140784324-140784346 CCTGGGGTGTTCCTTTTGGTGGG - Intergenic
963012545 3:140785911-140785933 CCTGGGGTGTTCCTTTTGGTGGG + Intergenic
964046516 3:152334549-152334571 CCTAATATTTTCCCATTGGTTGG + Intronic
965450554 3:168833110-168833132 CCTTAGGTGTTCCCTCTGGTAGG - Intergenic
967665529 3:192167487-192167509 ACTGTGCTTTTCCAATTGGTAGG - Intronic
969673003 4:8599944-8599966 CCTGAGCACTTCACATTGGTTGG - Intronic
972219246 4:36935535-36935557 CCTCAGGGTTTCCCTTGGGTAGG - Intergenic
976482503 4:85561253-85561275 CCTGTGGTTTTCCCACTGCCTGG - Intronic
980545164 4:134251703-134251725 CTTCAGGTTTTCCAATTTGTTGG + Intergenic
982229667 4:153196810-153196832 ACTGAGGTTTTCCGTTTGTTGGG - Intronic
986730674 5:10632651-10632673 CCTGAGGCTCTCCCAGTGGTGGG - Intronic
987071808 5:14344319-14344341 CAGGTGGTCTTCCCATTGGTGGG + Intronic
989252279 5:39331585-39331607 ACTGAGTTTTTCACATTGTTTGG + Intronic
989347529 5:40446643-40446665 CCTGAGGTTTCCCCAGTCATGGG - Intergenic
993869929 5:93240552-93240574 CCTGTGGGTTTCCCCTTGGGAGG - Intergenic
995230129 5:109751512-109751534 CTTGAGTTTTTCCCAGTAGTGGG + Intronic
997105229 5:131010807-131010829 GCTGAGGTTTTCCAATTTATTGG - Intergenic
997444783 5:133933225-133933247 CCTTAAGTTCTCCCAGTGGTGGG + Intergenic
1000453203 5:161416323-161416345 TCTGAGGTTTTCGTATTGGCTGG - Intronic
1001955149 5:175843789-175843811 CCTGAGGCTTTCCCCTCAGTTGG - Intronic
1002157464 5:177294409-177294431 CCAGAGGTCTTTCCAGTGGTTGG - Exonic
1006047067 6:31307589-31307611 CCTGAGGCTCTCCCATGGGTGGG - Intronic
1009957996 6:70479673-70479695 CCTGAAGTTTTATTATTGGTGGG + Intronic
1011382331 6:86756231-86756253 CCTAAAGTTTTCTCATAGGTAGG + Intergenic
1011729517 6:90246387-90246409 CCTGAGGTTTTCTGATTAGTTGG - Intronic
1011922654 6:92600106-92600128 CCTCAGGTTTTCTGGTTGGTAGG - Intergenic
1019782553 7:2952369-2952391 CCTGGGGATTTCACAGTGGTGGG + Intronic
1020577474 7:9951884-9951906 ACTGAGGTTTTTCCATAGCTTGG + Intergenic
1020644877 7:10802623-10802645 GCTGAGGTTTACACAGTGGTAGG + Intergenic
1023616942 7:42029508-42029530 CCTGAGGTTTTCCCACTAGGGGG + Intronic
1035178187 7:157068500-157068522 CTCTAGGTTTTCCCATTTGTTGG + Intergenic
1035189742 7:157155826-157155848 ACTGTGGATTTCACATTGGTGGG + Intronic
1035197222 7:157231713-157231735 GGTGAGGTCTTCTCATTGGTGGG - Intronic
1035607006 8:936339-936361 CCCGAGTTTTACACATTGGTCGG - Intergenic
1035700393 8:1634399-1634421 CCTGTGGATTTCCCTTGGGTGGG - Intronic
1036176898 8:6547827-6547849 GCAGAGGTTTTCCTATTGTTAGG + Intronic
1037608486 8:20457209-20457231 CATGAGATTTTCCCACTGATTGG - Intergenic
1041021078 8:53639347-53639369 CCTGGGATTTTTTCATTGGTAGG + Intergenic
1045948186 8:107821095-107821117 CGTGAGGTTTTCCTATGTGTTGG + Intergenic
1047409566 8:124613230-124613252 CCCAAGGTTATACCATTGGTTGG - Intronic
1048576913 8:135699636-135699658 TGTTAGGTTTTCCCATTTGTTGG + Intergenic
1048586146 8:135776008-135776030 CCAGACCTTGTCCCATTGGTTGG + Intergenic
1059253607 9:112909150-112909172 CTAGAGATTTCCCCATTGGTAGG - Intergenic
1059950256 9:119454861-119454883 CCTGAGGTTGTCCAAATGGTTGG - Intergenic
1060134960 9:121144678-121144700 CCTGTGTTGTTCCCATTGTTGGG - Intronic
1060728945 9:126024994-126025016 CCTGAGCTGTCCCCATTGGACGG - Intergenic
1060828764 9:126701032-126701054 CCTGTGGTCTTCTCCTTGGTGGG + Exonic
1061028493 9:128065938-128065960 CCTGAGGTTTTCCCAACTGATGG + Intronic
1186609078 X:11121131-11121153 CCTGAGGTTTGCCCATTAATGGG + Intronic
1188149437 X:26653570-26653592 CCCGATATTGTCCCATTGGTAGG - Intergenic
1190601730 X:52099628-52099650 ACTTAGGTTTTCCAATTGGGAGG + Intergenic
1193497703 X:82234939-82234961 GCTTATGTTTTCCCTTTGGTTGG + Intergenic
1195379971 X:104261131-104261153 ACTGTGGTTCTCCCAATGGTGGG - Intergenic
1201903979 Y:19071053-19071075 CCTGAGGTTTTACCAGAGTTGGG - Intergenic