ID: 1103238393

View in Genome Browser
Species Human (GRCh38)
Location 12:119393880-119393902
Sequence AGGTGCTGGTTAAAGTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103238393_1103238397 11 Left 1103238393 12:119393880-119393902 CCATCAGACTTTAACCAGCACCT 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1103238397 12:119393914-119393936 GCACGTACACACGCCATGTTTGG 0: 1
1: 0
2: 0
3: 1
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103238393 Original CRISPR AGGTGCTGGTTAAAGTCTGA TGG (reversed) Intronic
906247804 1:44289420-44289442 AGGAGCTAGTTAGGGTCTGAGGG - Intronic
907621428 1:55984894-55984916 AGGTGCTACTAAAAGTCAGAAGG - Intergenic
907666029 1:56434607-56434629 AGGTGCTGTTTAAAGTTTACTGG - Intergenic
908316408 1:62937150-62937172 AGCTTCTGGTTAGACTCTGAAGG + Intergenic
908636826 1:66176024-66176046 AGAAGCTGGTTAAAGGCAGATGG + Intronic
909039439 1:70631259-70631281 AGGTTCTGATTGAGGTCTGAGGG - Intergenic
909496882 1:76288784-76288806 AGGTGATGGTCAGAGTCAGATGG + Intronic
910012739 1:82485805-82485827 AGGTGCTCCTTAAAGCCTGCTGG + Intergenic
910431694 1:87165984-87166006 AAGTCCTGGTTCAAGTCTGAAGG + Intronic
912577875 1:110691986-110692008 ATGTGCAGGTCAAAGTCTGGAGG + Intergenic
912693176 1:111819886-111819908 TGGTCCTGGTTAAAGACGGAAGG - Intronic
912864940 1:113248421-113248443 AGGTGCTGGTTGAAGTTCAATGG - Intergenic
913673102 1:121116515-121116537 AGATACAGGTTAAAGGCTGAAGG + Intergenic
914024879 1:143903876-143903898 AGATACAGGTTAAAGGCTGAAGG + Intergenic
915554733 1:156655057-156655079 AGGTGGATGGTAAAGTCTGAAGG + Intronic
919351517 1:196461158-196461180 ATTTACTGGTTAAAGTCTAACGG - Intronic
920124878 1:203686225-203686247 AGATCCTGTTTAAATTCTGATGG - Intronic
1063435555 10:6026945-6026967 AGGTGCTGGGCAGAGTCTAAGGG - Intronic
1065435056 10:25697471-25697493 ATGTGTTGGTGAATGTCTGAGGG + Intergenic
1066121807 10:32296529-32296551 AGGTCCTTGTTAATGTCAGAGGG - Intronic
1071535442 10:86425132-86425154 AGGAGCTGGTTAATGGGTGATGG + Intergenic
1072764245 10:98083079-98083101 TGGTGCTGGGGCAAGTCTGAGGG + Intergenic
1074264251 10:111885498-111885520 AGGAACTGGTTAAAGTTTAATGG - Intergenic
1074414646 10:113256719-113256741 GGGTGCTGGTTAAAAACTGTAGG - Intergenic
1075899301 10:126026345-126026367 AGGTGGGTGTTAAAGTCTGCAGG - Intronic
1076763176 10:132615814-132615836 AGGAGCTGGTTGGAGACTGAGGG + Intronic
1077362289 11:2146035-2146057 AGGTGCTGGTTCAGGGCTGGGGG - Intronic
1079552801 11:21721308-21721330 AGGTTATGGTTAAAATTTGAGGG + Intergenic
1080316448 11:30955591-30955613 AGGTGGTGGTGAAAGGGTGATGG - Intronic
1083480907 11:62946100-62946122 AGGTGCTAGGAAAAGTTTGAAGG + Intronic
1083988959 11:66234978-66235000 AGGTGATGGCAAAAGTCTGTGGG + Intronic
1085158900 11:74322879-74322901 GGGTGCTGGCTAATTTCTGATGG - Intergenic
1087361508 11:97166227-97166249 AGATGCTTGTTAAAATCTAAAGG + Intergenic
1088515733 11:110631536-110631558 AGGTGCTGGGTGTAGTTTGATGG - Intronic
1093299011 12:17429611-17429633 AGCTGGTGATTAAAGTCTGATGG - Intergenic
1094003012 12:25716502-25716524 TGGTGATGGGAAAAGTCTGAGGG + Intergenic
1094285749 12:28791426-28791448 ATGTCCTAGTTCAAGTCTGAAGG - Intergenic
1095146399 12:38733694-38733716 ATGTGTTATTTAAAGTCTGAGGG + Intronic
1096575704 12:52551569-52551591 AGGAGCTGGCTAAGCTCTGATGG + Intronic
1096877362 12:54640666-54640688 ATGTTGTGGTTCAAGTCTGAAGG + Intergenic
1097419804 12:59362082-59362104 ATGTGTTGGTTATAGTTTGATGG - Intergenic
1099441136 12:82701393-82701415 AGGTCCTGGTGAGAGTATGAAGG - Intronic
1100213381 12:92421694-92421716 AACTCCTGGTTTAAGTCTGAAGG - Intronic
1101691972 12:107091389-107091411 AGATGCTGGTTATATTCTGAAGG - Intronic
1101797550 12:107989701-107989723 AGGTGCTGCTCAAAGTCTCTTGG + Intergenic
1101924181 12:108957464-108957486 AGCTGTTGCTTAAAGTCTAATGG - Intronic
1102149314 12:110677808-110677830 AGGAGCTGCTTACAGGCTGAGGG + Intronic
1102773008 12:115494904-115494926 ACGTGTAGGTTAAATTCTGAGGG + Intergenic
1103238393 12:119393880-119393902 AGGTGCTGGTTAAAGTCTGATGG - Intronic
1106703994 13:32261046-32261068 AGCAGCTGGGCAAAGTCTGATGG - Intronic
1107535157 13:41322232-41322254 AGCTGGTGGTGAAAGTGTGAAGG + Intronic
1107585926 13:41848365-41848387 ATGTGCTGGTTGAACTCTCAGGG + Intronic
1109620745 13:64901342-64901364 AGTTGCTGGGTAAAGTCTTTTGG - Intergenic
1115009373 14:28525666-28525688 TGGTGCTGGTAAGTGTCTGATGG + Intergenic
1117458618 14:55922447-55922469 AAGTCCTGGTTGGAGTCTGAAGG + Intergenic
1120515468 14:85464969-85464991 ATGTGCTAGTTTAAGTCTGCAGG + Intergenic
1121218917 14:92271205-92271227 AGGTGCTGCTTAAAGTATCTGGG - Intergenic
1121302831 14:92885586-92885608 AGGTGAGGGTTGAAGTGTGAAGG + Intergenic
1125412629 15:39420888-39420910 AGGTGCGGGATATAGTCTGGTGG - Intergenic
1126968555 15:54083764-54083786 CTGTGCTTGTGAAAGTCTGAGGG + Intronic
1129250934 15:74308634-74308656 AAGAGCTGGCTAAAGGCTGAAGG - Intronic
1131078438 15:89513892-89513914 AAGTGCTGGATACAGTCAGAAGG - Intergenic
1131868212 15:96734180-96734202 TGGTCCTGGTTAAAGACTGCTGG + Intergenic
1132342103 15:101085306-101085328 AGGCGCTGGGTAAATTCTGGTGG + Intergenic
1132811722 16:1802523-1802545 AGCTGCTTCTGAAAGTCTGATGG + Intronic
1133987299 16:10678126-10678148 AGGTCCTGGGTAACTTCTGAAGG + Intronic
1135609102 16:23849328-23849350 AGGTGGAGGGTGAAGTCTGAAGG + Intronic
1135626333 16:23998188-23998210 AGGTCCTGGTCCACGTCTGAAGG - Intronic
1138626375 16:58255191-58255213 AGCTGCTGGTACAAGTCCGAGGG + Intronic
1140900964 16:79367316-79367338 AGCTGCTGGTTGAAGTCACAGGG + Intergenic
1140929579 16:79614808-79614830 AGGTGCTGGTTTGAGTTTGCTGG - Intergenic
1141215980 16:82024212-82024234 AGGTAGTGGATAAATTCTGAAGG + Intergenic
1143467831 17:7149741-7149763 AGGTGCTGGTTGAAGGCAGAGGG + Intergenic
1146131571 17:30281392-30281414 ATGTGCACATTAAAGTCTGATGG + Intronic
1147055879 17:37834692-37834714 AGGTGCTCCTTCATGTCTGAAGG - Intergenic
1147338842 17:39742171-39742193 AGGTGCTAGGTAAACTCTGAGGG + Intronic
1148577290 17:48720836-48720858 AGGTGCTTGTTAGTGTCTGAAGG + Intergenic
1150359181 17:64515576-64515598 TGGTGGTGGTGAAAGACTGAAGG + Intronic
1156466205 18:37349116-37349138 AGGTGCTGGACACAGTTTGAAGG + Intronic
1157341483 18:46781927-46781949 AGGTGCTGGCTAAAGGCAGAGGG + Intergenic
1167761546 19:51453008-51453030 CGGTGCTGGATAAACTATGATGG + Intronic
1167813434 19:51855892-51855914 GGGTGGTGGTTGAAGGCTGATGG + Intronic
925957121 2:8977826-8977848 AGGTTTTGGTTGAAGTGTGATGG - Intronic
925987440 2:9227623-9227645 AGATCCTGGTTAAAGTCTCAGGG - Intronic
928337036 2:30407000-30407022 AGGAGCTGGTTTCTGTCTGAGGG + Intergenic
933123601 2:78574760-78574782 AGGTGATGGTTAGTCTCTGATGG + Intergenic
943339016 2:186654660-186654682 AGGTTCTGCTTAAAGGCAGATGG + Exonic
947120001 2:226803891-226803913 AGGTTCTGGTTAAATGCAGAAGG + Intergenic
947500094 2:230665253-230665275 AGATGCTAGTGAAAGTCTGAAGG - Intergenic
947541864 2:230985426-230985448 AGGTGCTGGATAAAGTCACTGGG + Intergenic
1169729957 20:8776072-8776094 AGTTGCTGGAGAAAGTCAGAAGG - Intronic
1170367280 20:15611572-15611594 AGGTGCTGGTCACAGTCCCATGG + Intronic
1170586112 20:17735388-17735410 ATGTGCTTGTCAAAGTTTGAAGG + Intronic
1174365982 20:50056719-50056741 AGGTGCTGTCTAGACTCTGATGG + Intergenic
1175109782 20:56639533-56639555 AGGTGTTGGGAAATGTCTGAGGG + Intergenic
1177194554 21:17889437-17889459 TAGTGCTGGTTCCAGTCTGAAGG - Intergenic
1179180328 21:39039307-39039329 AGGTGCTGTTTAGCTTCTGAGGG - Intergenic
1179583277 21:42358522-42358544 AGCTGCTGGTTCAGGGCTGAAGG + Intergenic
1180322632 22:11337107-11337129 AGGTGCGGGTTATAATCTCAGGG + Intergenic
1180714817 22:17864684-17864706 AGGTGCTGGTGCAAATCAGAGGG - Intronic
1181640127 22:24191840-24191862 GGGAGCTGGTGAAAGCCTGAAGG - Intergenic
1183164955 22:36140619-36140641 AGGTGGTGGTTGTAGTGTGATGG - Exonic
1183488300 22:38102167-38102189 AGGTCCCTGGTAAAGTCTGAAGG + Intronic
1183492407 22:38123593-38123615 AGGTGCCTGATAAAGTCTGTTGG + Intronic
1185020593 22:48372477-48372499 AGGAGCTGGTAAAAGACTGGGGG + Intergenic
949908333 3:8878124-8878146 AGATGCTGGTAGAAGTCTGTCGG + Exonic
951920727 3:27851812-27851834 AGGTGCATTTTAAAGTCAGATGG + Intergenic
953697745 3:45172923-45172945 AGGTGCTGGCCAAGGTCTGTGGG + Intergenic
959616599 3:108355862-108355884 AGGTGTTGGATAAAGATTGATGG - Intronic
970537300 4:17042456-17042478 AGGTGCTGGGAAGAGACTGAGGG - Intergenic
975177675 4:71306888-71306910 AGGTTCTGGTTAATGTCATAAGG + Intronic
976027931 4:80713547-80713569 AAGTGCTGCATAAATTCTGATGG - Intronic
976743099 4:88377386-88377408 AGGTGATGCTTAAAGCCAGATGG - Intergenic
981033430 4:140149073-140149095 AGGTCCTGGTTAAAATTTTAAGG - Intronic
981155234 4:141427211-141427233 TGTTGCTGGTCTAAGTCTGAGGG - Intergenic
981279323 4:142939199-142939221 AGGTCCTGGTCTGAGTCTGAAGG - Intergenic
984774488 4:183468746-183468768 TGGTGTTTTTTAAAGTCTGATGG + Intergenic
984891736 4:184500047-184500069 AAGTCCTGGTTCAAGTCTGAAGG + Intergenic
988160555 5:27514926-27514948 AGGTGCTTGCTAAAGTCAAAGGG - Intergenic
989975482 5:50581326-50581348 AAGTCCTGGTTGAAGCCTGAAGG - Intergenic
991628923 5:68634515-68634537 GGTTGATGGGTAAAGTCTGAGGG + Intergenic
993188838 5:84654884-84654906 AGGTGCTGGATACAGGCTAAGGG + Intergenic
995584729 5:113636458-113636480 AGCTGCTGGTGAAAGTCCCAGGG - Intergenic
996420876 5:123260850-123260872 AAGTGCTGGTTAACCTTTGAGGG + Intergenic
997147838 5:131456728-131456750 TGGTGTTGGTAAAAGTCAGATGG - Intronic
998300058 5:141009487-141009509 AGTTGTTTGTTCAAGTCTGAGGG - Intronic
1000197537 5:158973908-158973930 AGGTGGTGGCAAAAGACTGAGGG - Intronic
1002056664 5:176601806-176601828 AGATGCTGGATATATTCTGATGG - Intronic
1003799422 6:9646591-9646613 AGGAGCTGATTAAAGTGTGCTGG - Intronic
1004718936 6:18247974-18247996 AGGTGCAGGTTAAAAAGTGAGGG - Intronic
1004887013 6:20060868-20060890 AAGTGCAGGTTGAAGTGTGAAGG + Intergenic
1005417400 6:25614919-25614941 AGGAGCTGGTCAAATTTTGATGG + Intronic
1008801114 6:55369122-55369144 AGGTGCTGGATAGAATCTCATGG + Intronic
1011028412 6:82894587-82894609 AGGTGAGGGTTAAAGACAGAGGG - Intronic
1012431466 6:99168248-99168270 AAGTGCTGGTTAAAGGTTAAAGG + Intergenic
1017458546 6:154625864-154625886 AGGAGCTGGTTCAACTCTGTTGG + Intergenic
1018351434 6:162963372-162963394 AGGTGCTGATAAAACTCTCATGG + Intronic
1018945989 6:168346841-168346863 GGGTGCAGGTGAAAGTGTGAAGG + Intergenic
1019085361 6:169470351-169470373 AGGTGATGGATAGAGTCTGGGGG - Intronic
1019398490 7:836553-836575 ATGTTCTGGTTTGAGTCTGAAGG + Intronic
1020364522 7:7366492-7366514 AGGTGCATGTTATATTCTGAGGG + Intronic
1022332601 7:29394594-29394616 AGGTGCTGGTCAAATTCCCAGGG - Intronic
1022370032 7:29761798-29761820 AAATCCTGGTTCAAGTCTGAAGG - Intergenic
1023694221 7:42828257-42828279 GGGAGCTGGTTAAAGAATGATGG - Intergenic
1024130253 7:46344889-46344911 AGGTGCTCTTCAAAGTCAGAGGG - Intergenic
1024158942 7:46654812-46654834 AGGTGCTTGCTAAAGTCAAAGGG - Intergenic
1024884095 7:54122716-54122738 AGGTGCTTGCTAAAGTCAAAAGG - Intergenic
1028893708 7:96017041-96017063 CGGTGCTTGTTAAAATATGAAGG - Intronic
1032564371 7:132926432-132926454 AGCTGCTGGTTTATATCTGATGG + Intronic
1034891500 7:154843441-154843463 AGGTTCTGGTCTAAGTCTGAGGG - Intronic
1035141468 7:156766736-156766758 AGCTGCTGGTGACAGTCTGCAGG + Intronic
1035667242 8:1388317-1388339 AGGTGCTGGTTCAAGTGTCAGGG + Intergenic
1035667262 8:1388418-1388440 AGGCGCTGGTTCAAGTGTCAGGG + Intergenic
1035667329 8:1388774-1388796 AGGCGCTGGTTCAAGTGTCAGGG + Intergenic
1035667349 8:1388875-1388897 AGGCGCTGGTTCAAGTGTCAGGG + Intergenic
1035858589 8:3003782-3003804 AGGTGGCATTTAAAGTCTGAAGG + Intronic
1036618582 8:10407273-10407295 GGGAGCTGATGAAAGTCTGATGG - Intronic
1036951522 8:13144272-13144294 GGGCACTGGTTCAAGTCTGAAGG - Intronic
1038076866 8:24085616-24085638 TGGTGTTGCTTAAAGTCTGAGGG + Intergenic
1040454258 8:47580098-47580120 ACTAGCTGGTTAGAGTCTGATGG - Intronic
1040486986 8:47883029-47883051 AGGTGCTGGATACAGTATGTCGG - Intronic
1047259662 8:123244257-123244279 AGGTGCTGGTTACCTTGTGATGG - Intronic
1051739866 9:20240832-20240854 AGGGGCTGGTGAAAGTATTATGG - Intergenic
1052306786 9:27019297-27019319 AGGTGATGGTTAAAGGGTGCAGG - Intronic
1057944011 9:99308971-99308993 AGGAGGTGGTTAAAGAATGATGG - Intergenic
1058681508 9:107444377-107444399 AGGAGCTGTTGAATGTCTGAAGG + Intergenic
1060666561 9:125435503-125435525 AGGGGCTTGTTCAAGTCGGAGGG + Intergenic
1185587333 X:1249594-1249616 GGGAGCTTGTTAAAGCCTGAAGG + Intergenic
1187334130 X:18366983-18367005 TGATGCAGGTTAAAGTTTGAGGG + Intergenic
1188611712 X:32107545-32107567 ATATTGTGGTTAAAGTCTGAAGG + Intronic
1194870974 X:99130522-99130544 AAGTCTTGGTTCAAGTCTGAAGG - Intergenic
1195560962 X:106283136-106283158 AGGTGCTAGGTAAAGTCTCTAGG - Intergenic
1198963302 X:142204578-142204600 AGTTGCTAATTAAATTCTGAGGG - Intronic
1200908206 Y:8507481-8507503 AGGTGCTGTTTACAGTGTGGAGG - Intergenic