ID: 1103239959

View in Genome Browser
Species Human (GRCh38)
Location 12:119404787-119404809
Sequence TTGTCTCTAAGGGGCCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103239959_1103239964 4 Left 1103239959 12:119404787-119404809 CCAGCAGGGCCCCTTAGAGACAA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1103239964 12:119404814-119404836 CCTCACCACTCCCTCCCCAAAGG 0: 1
1: 0
2: 3
3: 41
4: 424
1103239959_1103239969 17 Left 1103239959 12:119404787-119404809 CCAGCAGGGCCCCTTAGAGACAA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1103239969 12:119404827-119404849 TCCCCAAAGGCACATGGAGATGG 0: 1
1: 0
2: 0
3: 20
4: 252
1103239959_1103239966 11 Left 1103239959 12:119404787-119404809 CCAGCAGGGCCCCTTAGAGACAA 0: 1
1: 0
2: 1
3: 11
4: 113
Right 1103239966 12:119404821-119404843 ACTCCCTCCCCAAAGGCACATGG 0: 1
1: 0
2: 1
3: 21
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103239959 Original CRISPR TTGTCTCTAAGGGGCCCTGC TGG (reversed) Intronic
900289206 1:1916733-1916755 TTGTCTGCAAGGGGCACAGCTGG - Exonic
900344991 1:2206235-2206257 CTGTCTCTAACGGGCCATACGGG + Intronic
902145614 1:14396285-14396307 ATGTCTCTAGGGGGATCTGCAGG + Intergenic
902188280 1:14741743-14741765 TTGTCTTCAAGGGGCCATTCTGG - Intronic
902308389 1:15561382-15561404 TAGTTTCTAAAAGGCCCTGCCGG + Intronic
904080313 1:27868415-27868437 TTGTCTCAGAGGGGCCATGCAGG + Intergenic
904988691 1:34573886-34573908 TCTTCTCCAAGAGGCCCTGCTGG - Intergenic
906942590 1:50268628-50268650 TTGTCTCTGGGGAGCCCTTCTGG + Intergenic
912671589 1:111632955-111632977 TTCTCTCTGAAGGTCCCTGCAGG - Intronic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
919992233 1:202716144-202716166 TTATCTGTCAGGAGCCCTGCAGG + Intergenic
920354257 1:205358728-205358750 TTGTCTCCCAGATGCCCTGCTGG + Intergenic
921167717 1:212518881-212518903 TTGTTTCCAAGGGGACCAGCAGG - Intergenic
922997152 1:229973234-229973256 AAGTCTCAGAGGGGCCCTGCGGG - Intergenic
923393463 1:233536647-233536669 TTGTACCTATGGGGCCATGCTGG - Intergenic
1066452565 10:35544582-35544604 CTGTCTCTAATGGGCTTTGCTGG - Intronic
1067911241 10:50349110-50349132 CTGTCTCAAAGAGGCCCTGATGG - Intronic
1068912812 10:62396614-62396636 ATGTCACTAATGGGCCCTGCTGG - Intronic
1069590758 10:69640340-69640362 TTTTCACTAATGGGCCCTGTAGG - Intergenic
1069951912 10:72024888-72024910 TTGCCTCTATGGGTCCTTGCTGG - Intergenic
1072660409 10:97360363-97360385 TGGAGTCTAAGGGGCCCTGGGGG - Intronic
1073845042 10:107544999-107545021 TTCTTTCCAAGGGGGCCTGCAGG - Intergenic
1075786934 10:125056497-125056519 TTGGCTCTAAGGAGCCCAGGAGG + Intronic
1076380715 10:130023042-130023064 GTGTCACTGGGGGGCCCTGCCGG + Intergenic
1076903024 10:133349055-133349077 TTGTCTCTTCAGGGCCCTGCGGG - Intronic
1077557464 11:3232497-3232519 TGGTCCCTAAAGGGCCCTACAGG - Intergenic
1080874811 11:36265870-36265892 TTGTATCTAATGGGCCCTAATGG + Intergenic
1083583527 11:63839851-63839873 TTTTCTCTCAGGGGCCTTTCTGG + Intronic
1084019676 11:66410070-66410092 TTGACTCTGGGGAGCCCTGCCGG - Intergenic
1092104788 12:5913643-5913665 CTGCCACTAAGGGGTCCTGCTGG - Intronic
1099682417 12:85844863-85844885 CTCTCTCTTTGGGGCCCTGCAGG + Intergenic
1101332914 12:103771611-103771633 TTGTCCCCAGGGGGCACTGCTGG + Intronic
1101566172 12:105907716-105907738 TTGGCTCTAAGTGGCCCTTTAGG - Intergenic
1103239959 12:119404787-119404809 TTGTCTCTAAGGGGCCCTGCTGG - Intronic
1104795107 12:131511790-131511812 TATTCCCTAAAGGGCCCTGCAGG + Intergenic
1117003524 14:51395399-51395421 TTGACTCTGAGGGGCACTGCTGG + Intergenic
1117776447 14:59189069-59189091 TTCTTTCTAAGGCGCCCGGCTGG + Intronic
1121190622 14:92026176-92026198 TTGTCTTTCAGGGTCCCTGAAGG + Intronic
1122441267 14:101733714-101733736 TCATCTCTAAGGAGGCCTGCTGG + Intergenic
1122954930 14:105066128-105066150 TTCTCTGTGAGGGGCCCTGTGGG + Intergenic
1123149895 14:106170635-106170657 TTGTCCCCAAGGTGCCCTGGTGG + Intergenic
1127134046 15:55900391-55900413 TTGTATCTACTGGTCCCTGCAGG + Intronic
1129911209 15:79228020-79228042 CTGGCTCTCAGGGGACCTGCAGG + Intergenic
1131256015 15:90862999-90863021 TGCTCTCTAAGGGGCCTTGGTGG - Intergenic
1133737777 16:8629002-8629024 TTGTCTCTCAGAGGCCCTGCTGG - Exonic
1133930784 16:10230478-10230500 TTGTCTCTCAGGGGCTCATCGGG - Intergenic
1137619670 16:49868127-49868149 CAGTCTGTAAGGGGCACTGCAGG - Intergenic
1141847210 16:86618994-86619016 GTGTGTCCAAGGGGCCCTGCAGG + Intergenic
1145117689 17:20226860-20226882 TTATCTCTAAGGGAACCTGGGGG + Intronic
1150657733 17:67051364-67051386 TGGTCTCTAATGGCCCCTGTAGG - Intronic
1151963337 17:77418936-77418958 CTGTCTCCCAGGGTCCCTGCGGG + Intronic
1157832236 18:50867063-50867085 ATGTCTTTAATAGGCCCTGCAGG - Intergenic
1158613855 18:58968167-58968189 TTATCTCTAAGGGGCCCAGAAGG + Intronic
1159672689 18:71241500-71241522 TTGTCTCTACTGGTCCCTGAAGG + Intergenic
1161533256 19:4803089-4803111 TTGTCTCTGAGGGGCCTTTCTGG + Intergenic
1162032462 19:7923417-7923439 CTGTCCCCAAGGTGCCCTGCCGG - Intergenic
1162461600 19:10817079-10817101 GTGACTCCAAGGGTCCCTGCTGG - Intronic
1163362575 19:16856436-16856458 TTGTATTTGAAGGGCCCTGCAGG - Intronic
925404824 2:3599265-3599287 ATTTCTGTAAGGGGCTCTGCAGG + Intronic
928169179 2:28992378-28992400 GGGTCTCAAAGGGGCTCTGCTGG + Intronic
936988203 2:118332245-118332267 TTATCTCCATGGGGGCCTGCTGG - Intergenic
937797988 2:126048102-126048124 TTGTCCCAGAGGGGCCCAGCAGG - Intergenic
937968777 2:127534297-127534319 TTGTCTCTAAGGCTTCCTGATGG + Intergenic
1180125716 21:45788664-45788686 TCGTCTCTGAGGGGCCCTCGTGG - Intronic
1180225338 21:46388733-46388755 CTGTCTCAGAGGGGCCCTCCAGG + Exonic
1183541542 22:38431957-38431979 TTTTTTTTAAAGGGCCCTGCTGG + Intronic
1184476793 22:44726496-44726518 TGGACTCTCGGGGGCCCTGCTGG + Intronic
949987374 3:9551979-9552001 GTGTCTCTAAGGGTCTCTGTTGG - Intronic
950900998 3:16497492-16497514 TTCTCCCTACTGGGCCCTGCTGG + Intronic
953665941 3:44926656-44926678 TTGTGTCTGAGTGGCCATGCCGG + Exonic
954104543 3:48402902-48402924 TTGTCCCTAAGGAGCCATGTTGG - Intergenic
954896929 3:53983550-53983572 TTGTCTATAAGTTGACCTGCTGG + Intergenic
955291100 3:57692996-57693018 ATGGCTTTGAGGGGCCCTGCGGG - Exonic
956366053 3:68504298-68504320 TGGCAGCTAAGGGGCCCTGCTGG - Intronic
959808554 3:110589314-110589336 TGATCTCTAAGGGGCCTTGCAGG + Intergenic
960635449 3:119780542-119780564 GTGTTTCTCAGGGGACCTGCAGG + Intronic
961311362 3:126004050-126004072 TTGTGTCAAAGGGCACCTGCAGG - Intergenic
968087630 3:195881083-195881105 TCCTCTCCAAGGGGCACTGCTGG - Intronic
968087643 3:195881133-195881155 TCCTCTCCAAGGGGCACTGCTGG - Intronic
968087693 3:195881337-195881359 TCCTCTCCAAGGGGCACTGCTGG - Intronic
968087706 3:195881387-195881409 TCCTCTCCAAGGGGCACTGCTGG - Intronic
978267732 4:106846501-106846523 TTTTCTCTTAGGGCACCTGCTGG - Intergenic
979082116 4:116358486-116358508 TAGTCCCTAAGGGGTCCCGCGGG + Intergenic
979112168 4:116773040-116773062 TTGTTTCTAAGGGGAAATGCAGG - Intergenic
983556220 4:169061423-169061445 TTGTCTTCAAGGAGCACTGCAGG - Intergenic
985414546 4:189722616-189722638 TTGTTTCTAACTGGCCCTGTGGG - Intergenic
986148268 5:5101406-5101428 TTGTGTCTATGTTGCCCTGCAGG - Intergenic
987017827 5:13838219-13838241 TTGTCTCTAAGGGTGCTTGCAGG - Intronic
988035666 5:25824066-25824088 CTGTCTCTAAGGAGACCTGGAGG - Intergenic
988908836 5:35819149-35819171 TTATATCTAAGAAGCCCTGCAGG - Intergenic
990059955 5:51635510-51635532 TTGTCTCTGAGTGGCCCTCAAGG - Intergenic
993477468 5:88382880-88382902 TTGCCTCTAAGGGACCTTGAAGG + Intergenic
1001554458 5:172626433-172626455 TGGTCTGTAAGGAGCCCTGAGGG - Intergenic
1001966063 5:175910757-175910779 CTATCTCTAAGGCTCCCTGCGGG + Intergenic
1002250883 5:177928445-177928467 CTATCTCTAAGGCTCCCTGCGGG - Intergenic
1005744733 6:28825841-28825863 TTGGCTCAAAAGGGCTCTGCAGG + Intergenic
1006119812 6:31796912-31796934 TGGTCTCTAAGGGTCCCTTAAGG + Intergenic
1006626263 6:35400215-35400237 TTGCCTCTCATGGGGCCTGCTGG + Intronic
1015264317 6:131275567-131275589 AAGTCTCTAAGGGGCTGTGCTGG + Intronic
1015522541 6:134146462-134146484 TTTTCTCCCAGGGGCCCTTCAGG - Intergenic
1015869511 6:137761690-137761712 TTTTCTCAAAATGGCCCTGCTGG - Intergenic
1020736658 7:11957809-11957831 TTCTCTCTATGGGGCTCTGGAGG + Intergenic
1022017738 7:26366575-26366597 TTGTCTCTATGAGGCCCAGGTGG + Intronic
1023935980 7:44739976-44739998 TTGGCTCTAAGTGGCCCACCCGG - Intergenic
1027139437 7:75646841-75646863 CTGGCTCTAAGTGGCACTGCAGG - Intronic
1027924803 7:84447246-84447268 TTGTCCCAAAGGGTGCCTGCAGG - Intronic
1032841928 7:135721336-135721358 CTCTCTTTCAGGGGCCCTGCAGG + Intronic
1035653851 8:1290554-1290576 TTGTTTCTAAAGGTCTCTGCGGG - Intergenic
1036143547 8:6230244-6230266 TTGTCTATATGGGTTCCTGCCGG - Intergenic
1036564299 8:9925171-9925193 TTGTCTCCAAGGGGACCCTCTGG - Intergenic
1043909344 8:85842724-85842746 TTGCCTGGAAGTGGCCCTGCAGG + Intergenic
1044261289 8:90125882-90125904 CTTTATCTAAGGGGCCCTGGTGG + Intergenic
1049551978 8:143264251-143264273 TTGTCTCTAGGGGTCCCTGTGGG - Intronic
1051049677 9:12916226-12916248 CTCTCTCTAAAGAGCCCTGCTGG + Intergenic
1053006286 9:34606957-34606979 TGGTCTCTACGGGGCCCAGCTGG - Intergenic
1053446663 9:38158391-38158413 TTGACTCTCATGGGCCCTCCAGG + Intergenic
1055168272 9:73223374-73223396 TTCTCTCTAAGAGTCCCTTCTGG + Intergenic
1057700449 9:97360164-97360186 TTGGCTCTACTGAGCCCTGCAGG - Intronic
1061719989 9:132545624-132545646 GTGTGTCTAAGGGTCTCTGCTGG - Intronic
1062174931 9:135156306-135156328 TTGTCTCTGGGGGGACCTGGTGG - Intergenic
1187107105 X:16254541-16254563 TTGTCTCTTAGGAGCCCAGGAGG + Intergenic
1192511825 X:71725008-71725030 ATTTCTCTAAGTGTCCCTGCAGG + Intergenic
1192514872 X:71756497-71756519 ATTTCTCTAAGTGTCCCTGCAGG - Intergenic
1197068671 X:122266870-122266892 CTGTCCCAAAGGGGCCATGCTGG + Intergenic
1197910606 X:131479333-131479355 TTGTCTCTCAGGGGTCCTTGGGG + Intergenic
1202063080 Y:20908649-20908671 TAGGCTCTAATGGGTCCTGCAGG + Intergenic