ID: 1103249554

View in Genome Browser
Species Human (GRCh38)
Location 12:119487789-119487811
Sequence CTTTGTATTAAACACCTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103249554_1103249555 2 Left 1103249554 12:119487789-119487811 CCTTGTAGGTGTTTAATACAAAG 0: 1
1: 0
2: 2
3: 14
4: 144
Right 1103249555 12:119487814-119487836 TCCAAAAAATCAGAAAATGTAGG 0: 1
1: 0
2: 5
3: 71
4: 797
1103249554_1103249557 16 Left 1103249554 12:119487789-119487811 CCTTGTAGGTGTTTAATACAAAG 0: 1
1: 0
2: 2
3: 14
4: 144
Right 1103249557 12:119487828-119487850 AAATGTAGGTGAGACATATGTGG 0: 1
1: 0
2: 0
3: 20
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103249554 Original CRISPR CTTTGTATTAAACACCTACA AGG (reversed) Intronic
905343784 1:37297579-37297601 CTTGGTATTTATCACCTCCATGG + Intergenic
909567232 1:77066883-77066905 CTTTAGTTTAAAAACCTACAAGG - Intergenic
910893075 1:92038483-92038505 ATCTTTATTAAGCACCTACAGGG + Intronic
911314023 1:96334227-96334249 AATTGTATTTAACACCTGCAGGG - Intergenic
916370498 1:164089054-164089076 CTATATATTATACACATACACGG + Intergenic
917249649 1:173044175-173044197 CTTTGTCTAAAAGACCTAAAAGG - Intronic
919291389 1:195637535-195637557 CTTTGCATTAAAGAACTTCATGG - Intergenic
920522303 1:206636286-206636308 CGTTGTATTTTACACCTAAATGG + Intronic
920856594 1:209667765-209667787 CTATGTATCAAACACCTCAAAGG + Intergenic
921065616 1:211620472-211620494 CTTTGTCTTGAACACCTCCAAGG - Intergenic
923134005 1:231101651-231101673 CTTTGTAAATAACATCTACATGG - Intergenic
1063824595 10:9879944-9879966 CTTTATATTTAAAAACTACATGG + Intergenic
1064877344 10:20009246-20009268 CTTAGAATAAAACACGTACAAGG + Intronic
1065696121 10:28381476-28381498 CCTTGAAATAAACACTTACATGG - Intergenic
1068975496 10:63004394-63004416 CTTTAGATTAAGGACCTACAAGG + Intergenic
1069072052 10:63998955-63998977 CACTGTAGTAAACACCTGCAGGG + Intergenic
1069244532 10:66187239-66187261 CTTTGTAGTAACTGCCTACAGGG - Intronic
1070220990 10:74444359-74444381 TTTTCTATTAAACACATACTTGG + Intronic
1073774650 10:106772164-106772186 TTTTCTATTCAACACCTCCAAGG - Intronic
1074565269 10:114571887-114571909 CTTTGTGCTGGACACCTACATGG + Intronic
1076152416 10:128173253-128173275 CTTTTTATTAATCAGCTCCAAGG - Intergenic
1078452878 11:11453292-11453314 CTTCTTGTTAAACACCTGCAAGG + Intronic
1078551249 11:12281825-12281847 CTTTGTATTAAACACAAGCTGGG - Intronic
1079158772 11:17973687-17973709 ATTAGTATAAAAGACCTACAGGG + Intronic
1080194158 11:29588347-29588369 TTTTTTATTAAGCACCTACCAGG - Intergenic
1080282861 11:30578689-30578711 TTTTGTATTAAAGAACTACAAGG - Intronic
1084131377 11:67138387-67138409 CTTTATTTTATTCACCTACAAGG + Intronic
1085371801 11:76014395-76014417 CTTTGTATAAAGCACATAGAGGG + Intronic
1085735797 11:79037989-79038011 CTTTTTATGAAACATCTCCAGGG + Intronic
1086551788 11:88060937-88060959 CTTTTTATTAAACTCCTTAAAGG - Intergenic
1087086690 11:94226522-94226544 TTTTGTATTAAGCCCCTACCAGG + Intergenic
1090914102 11:131147735-131147757 CTCTGTTTTAAACAGCTAAATGG + Intergenic
1091092615 11:132786685-132786707 TTTTTTTTTAAACACCTACATGG - Intronic
1094195714 12:27747796-27747818 CTTTGTATTACATTCATACAAGG + Intronic
1094459315 12:30677018-30677040 CTTTGTACTAAACAGATATATGG + Intronic
1099633243 12:85177353-85177375 ATTTGTGTTATACACTTACATGG - Intronic
1101148272 12:101862229-101862251 CTTTTTCTTAAAAACCTACTTGG - Intergenic
1102085207 12:110131658-110131680 CTTTATATTAAACACCTCCATGG + Intronic
1102987630 12:117291350-117291372 CTCTGTCTTGAACACCTACATGG + Intronic
1103019969 12:117526078-117526100 ATCTGTATTAAACACCGACTGGG + Intronic
1103249554 12:119487789-119487811 CTTTGTATTAAACACCTACAAGG - Intronic
1104505241 12:129325831-129325853 CTTTGAATTAAACTCATATAAGG - Intronic
1107056063 13:36104889-36104911 CATGGTATTATACAACTACAAGG + Intronic
1108064103 13:46559942-46559964 CTTTGTAATAAACATTTAAAGGG + Intronic
1108396808 13:49997505-49997527 CTTTGTATTAAGCAGCTTCTCGG - Intronic
1110117972 13:71843691-71843713 TTGTTTATTAAACACATACAAGG + Intronic
1114802049 14:25787075-25787097 CATTTTATTAAATATCTACATGG + Intergenic
1118860600 14:69660033-69660055 CTTTGTTAGAAACACATACATGG + Intronic
1120484732 14:85098754-85098776 ATTTCTATTAAACACCCCCAAGG - Intergenic
1121737584 14:96229130-96229152 CCATTTATTAAACACCTACTAGG + Intronic
1122284858 14:100644826-100644848 ATTTGGATTAAACCCCTCCAGGG + Intergenic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1128790602 15:70430873-70430895 ATTTATAAAAAACACCTACATGG + Intergenic
1131334829 15:91538707-91538729 CTATGAATTAAGCACCTACTAGG + Intergenic
1135607084 16:23834668-23834690 TTTATTATTAAACACCTACTGGG + Intergenic
1139007679 16:62593380-62593402 CTGCTTGTTAAACACCTACAAGG + Intergenic
1140396979 16:74635671-74635693 CTTTTTATTAAAAACTTAGATGG + Intronic
1140858354 16:78997708-78997730 CTTTGTATTATTCCCCTAGAAGG + Intronic
1141372792 16:83503092-83503114 ATGTGTATTGAGCACCTACAAGG - Intronic
1141926330 16:87172665-87172687 CTGGGTTTTGAACACCTACACGG + Intronic
1149502486 17:57164647-57164669 CTATGTATTAAGCATCTACTGGG + Intergenic
1150017605 17:61573890-61573912 CATTGTATTATACAACAACACGG - Intergenic
1150792141 17:68207334-68207356 CTTTGTATTAAATACGTAGTTGG + Intergenic
1152478368 17:80533269-80533291 CATTGTGTTAATCACATACAGGG - Intergenic
1155461266 18:26086763-26086785 CTTTGTTTTCACCACATACATGG + Intronic
1157421109 18:47548270-47548292 GTTTTTTTTAAACACCTACTTGG + Intergenic
1159967159 18:74606179-74606201 TTTTGTATTTAATAGCTACATGG + Intronic
1163899221 19:20086571-20086593 CTTTGAATTAATCACTTAAATGG + Intronic
1163933074 19:20417456-20417478 CTTTGAATGAATCACTTACATGG - Intergenic
1163957217 19:20654771-20654793 CTTTGAATTAATCACTTAAATGG - Intronic
1164210887 19:23096429-23096451 CTTTCTATTAATCACCTAGGTGG + Intronic
925526109 2:4804437-4804459 CATCATATTAAAAACCTACAAGG + Intergenic
925664187 2:6235902-6235924 CTTTTTGTTGAACATCTACATGG - Intergenic
929310624 2:40420234-40420256 CTTACTATTAACCACCTCCAGGG + Intronic
929649094 2:43659921-43659943 CTTTGAACTAAACACCCAAAAGG - Intronic
930192216 2:48471615-48471637 CTTTGCAGTTAACACCTAGATGG + Intronic
930451699 2:51547162-51547184 CTTTCTATTAAAAACCTACCTGG - Intergenic
930984811 2:57572615-57572637 ATTTTTATTAAACATCTATATGG - Intergenic
931639265 2:64367406-64367428 CTTTGTTTTCAACACCTTCTTGG + Intergenic
932392477 2:71408020-71408042 CTTTTTAGTATACACCTAAAAGG - Intronic
933916751 2:87002428-87002450 CTTTATAATAAACACATACTAGG + Intronic
934006243 2:87767486-87767508 CTTTATAATAAACACATACTAGG - Intronic
935571690 2:104669039-104669061 ATTTGTATTAAGCACCCACAAGG + Intergenic
935769893 2:106408376-106408398 CTTTATAATAAACACATACTAGG - Intronic
935910200 2:107887547-107887569 CTTTATAATAAACACATACTAGG + Intronic
936737340 2:115462480-115462502 CTTGGTATGACACACCTCCATGG + Intronic
937435458 2:121876873-121876895 CTTTGTAGTTTACAGCTACAGGG - Intergenic
944215722 2:197253674-197253696 CTGTGATTTAAACACCTACATGG - Intronic
944739988 2:202602628-202602650 CTTTGTATAATATACCTGCATGG + Intergenic
947155724 2:227161355-227161377 TTTTGTTTAAAACTCCTACATGG + Intronic
1169585290 20:7075268-7075290 ATTTGTATTAAAAACCTACAAGG - Intergenic
1169762750 20:9114205-9114227 CTTTGTCTTAAAAACCTAGAGGG + Intronic
1177634140 21:23765240-23765262 CTTTGAATTAAATATCTAAAGGG + Intergenic
1178097759 21:29234256-29234278 CTTTGTAATACATGCCTACATGG - Intronic
1180237434 21:46471831-46471853 CTTTGAATTAATCAGCTATAAGG + Intronic
1182252342 22:29011086-29011108 TTTTGTTTTAAACACATAGAAGG + Intronic
1183040688 22:35175606-35175628 CCTTGTATTAATCACCTACTAGG - Intergenic
1183348777 22:37322829-37322851 CATTGTCTTAAATACCTCCATGG + Intergenic
1184887725 22:47356667-47356689 CTTTGGATAAAACACCACCAAGG + Intergenic
952470401 3:33643830-33643852 CTTTTTATTAAAAACCAAAAAGG - Intronic
956115874 3:65918222-65918244 ATTTTTATTAAATACCTAGAAGG + Intronic
957596820 3:82277671-82277693 CGTTGTATGACACACGTACAAGG - Intergenic
959807171 3:110569679-110569701 GTTTGTTTTAAACATCGACATGG - Intergenic
960071677 3:113438132-113438154 GTTTATATAAAACACCTACTAGG + Intronic
960076988 3:113497581-113497603 CTGTCTAAAAAACACCTACATGG + Intronic
960645357 3:119874799-119874821 CTGTGTATTAAATAAATACAGGG - Intronic
961999262 3:131278135-131278157 ATTTATATTAAACAACTTCATGG - Intronic
962024997 3:131538489-131538511 TTATTTATTAACCACCTACATGG + Intronic
967101182 3:186217032-186217054 CTATGCATTAAACACCTGCTTGG - Intronic
968248651 3:197183414-197183436 TTTTGTGCTAAAGACCTACACGG + Intronic
970211657 4:13716185-13716207 CTGTGTATTATACTCCTAGAAGG + Intergenic
971059781 4:22954768-22954790 ATTTGTATTGAGCACCTAAAAGG + Intergenic
971474258 4:27057476-27057498 CCTTGTATTAAAGTCCTGCAAGG + Intergenic
971788475 4:31136219-31136241 CTATTTACTGAACACCTACACGG + Intronic
972343958 4:38177237-38177259 CTTTGGAGAAAAGACCTACAAGG - Intergenic
972997486 4:44898751-44898773 TTTAATATTAAACACCTGCAGGG + Intergenic
973208733 4:47590805-47590827 CTTTTTAATAAACACTTATATGG + Intronic
976952838 4:90854352-90854374 ATTTGCATGAAACACCTACTTGG - Intronic
978703518 4:111676685-111676707 CTTTGCATTAAACATCACCAGGG + Intergenic
980518310 4:133895006-133895028 ACATGTATTAATCACCTACAGGG + Intergenic
985751865 5:1684699-1684721 TTTTCTTTTAAACACCAACAAGG - Intergenic
987497466 5:18666121-18666143 CTTTGTAATAATAACCTACAAGG + Intergenic
987797285 5:22644717-22644739 CTTTCTATTAAAATCCTAAAAGG - Intronic
989552466 5:42751889-42751911 CCTTGTATTCAACAACTACTTGG - Intergenic
990006431 5:50948905-50948927 CTTTGCATGACACAACTACAAGG - Intergenic
994292738 5:98049197-98049219 CTTCATAATAAACATCTACAAGG + Intergenic
995961289 5:117842930-117842952 ATATATATTAAACATCTACATGG + Intergenic
1000810922 5:165859925-165859947 ATATTTATTGAACACCTACAGGG + Intergenic
1002859078 6:1064148-1064170 CTTTGTAGTGAAAACCAACAAGG + Intergenic
1006543017 6:34756042-34756064 TATTGTATTAAACACTTACAAGG + Intergenic
1008683800 6:53902312-53902334 CTGTGCATGAAACACCTCCACGG + Intronic
1009271224 6:61616763-61616785 CTTTGTATTAACCAGCTAAATGG - Intergenic
1011269105 6:85558330-85558352 CTTTGTATTAAATGCGTTCAAGG + Intronic
1016085508 6:139909267-139909289 CTTTGAAAGAACCACCTACATGG + Intergenic
1016875217 6:148857963-148857985 CTTTGCATTCAACACATACTTGG - Intronic
1020944959 7:14592235-14592257 CTTTGTATTAAAGAAACACAAGG + Intronic
1021108212 7:16664219-16664241 CTATGGAATAAAAACCTACAAGG + Intronic
1021578216 7:22124876-22124898 CTTTTTGTTCTACACCTACAGGG + Intronic
1028755198 7:94426224-94426246 GTTTGTATTAAACAATTACAAGG + Intronic
1031817791 7:126460656-126460678 CTCTGAATAAAGCACCTACAGGG + Intronic
1032351088 7:131164628-131164650 CTTTGGCTTAAATAGCTACATGG + Intronic
1032708022 7:134439044-134439066 GTTTGTTTTTAATACCTACAAGG - Intergenic
1033953820 7:146818517-146818539 TTTTGTTTTAAATACCTCCATGG + Intronic
1033994223 7:147325673-147325695 CTGTGTATTCAACACATAGATGG - Intronic
1043556482 8:81436387-81436409 CATTGCATTAAATGCCTACATGG - Intergenic
1047552697 8:125893747-125893769 CTTGGTATTGAACACCTATATGG + Intergenic
1048531455 8:135253870-135253892 CTTTGTAGCACACACCTACTTGG + Intergenic
1050067206 9:1772229-1772251 CTTTTTATCAAACACTTACTTGG + Intergenic
1050993850 9:12188472-12188494 CTATTTATTGAGCACCTACAAGG + Intergenic
1053671210 9:40364833-40364855 CTTTGTATTATACAGTTCCATGG + Intergenic
1054513406 9:66011467-66011489 CTTTGTATTATACAGTTCCATGG - Intergenic
1056956873 9:91089628-91089650 CTTTGCATTAAGCTCCTGCAGGG + Intergenic
1058303350 9:103405513-103405535 ATTTTTAGTAAACAGCTACATGG - Intergenic
1187042171 X:15608355-15608377 TTTTGGATTAAACAGCTAGAAGG + Intergenic
1188339825 X:28985588-28985610 ATTGGTATTCAGCACCTACACGG - Intronic
1188382996 X:29520498-29520520 ATTTGTGTTAAAGACTTACAAGG - Intronic
1188847383 X:35090135-35090157 CTTTTTATAAAATGCCTACAGGG + Intergenic
1196256632 X:113527729-113527751 CTTTGAATTATACACTTAAATGG - Intergenic
1196924398 X:120619269-120619291 CTTTGTATTAAATATCTTGATGG - Intronic
1197449802 X:126598090-126598112 ATTTACATTAAACACCAACACGG - Intergenic
1200233419 X:154457417-154457439 ATTTTTATTAAACACATATATGG - Intergenic