ID: 1103250511

View in Genome Browser
Species Human (GRCh38)
Location 12:119496027-119496049
Sequence TGTCCACTGGAGTACCACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 122}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103250511_1103250515 -8 Left 1103250511 12:119496027-119496049 CCACTGTGGTACTCCAGTGGACA 0: 1
1: 0
2: 2
3: 11
4: 122
Right 1103250515 12:119496042-119496064 AGTGGACATCTCTGTGGAGTGGG 0: 1
1: 0
2: 4
3: 25
4: 239
1103250511_1103250514 -9 Left 1103250511 12:119496027-119496049 CCACTGTGGTACTCCAGTGGACA 0: 1
1: 0
2: 2
3: 11
4: 122
Right 1103250514 12:119496041-119496063 CAGTGGACATCTCTGTGGAGTGG 0: 1
1: 0
2: 4
3: 37
4: 244
1103250511_1103250516 1 Left 1103250511 12:119496027-119496049 CCACTGTGGTACTCCAGTGGACA 0: 1
1: 0
2: 2
3: 11
4: 122
Right 1103250516 12:119496051-119496073 CTCTGTGGAGTGGGAGAATGTGG 0: 1
1: 2
2: 3
3: 41
4: 404
1103250511_1103250520 29 Left 1103250511 12:119496027-119496049 CCACTGTGGTACTCCAGTGGACA 0: 1
1: 0
2: 2
3: 11
4: 122
Right 1103250520 12:119496079-119496101 GGATCAGATCATCACTCAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 91
1103250511_1103250518 8 Left 1103250511 12:119496027-119496049 CCACTGTGGTACTCCAGTGGACA 0: 1
1: 0
2: 2
3: 11
4: 122
Right 1103250518 12:119496058-119496080 GAGTGGGAGAATGTGGCAGGAGG 0: 1
1: 0
2: 3
3: 78
4: 902
1103250511_1103250519 26 Left 1103250511 12:119496027-119496049 CCACTGTGGTACTCCAGTGGACA 0: 1
1: 0
2: 2
3: 11
4: 122
Right 1103250519 12:119496076-119496098 GGAGGATCAGATCATCACTCAGG 0: 1
1: 0
2: 1
3: 9
4: 100
1103250511_1103250517 5 Left 1103250511 12:119496027-119496049 CCACTGTGGTACTCCAGTGGACA 0: 1
1: 0
2: 2
3: 11
4: 122
Right 1103250517 12:119496055-119496077 GTGGAGTGGGAGAATGTGGCAGG 0: 1
1: 0
2: 5
3: 44
4: 578

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103250511 Original CRISPR TGTCCACTGGAGTACCACAG TGG (reversed) Intronic
900390912 1:2433415-2433437 TGTCCCCTGGAGTACTCCAGCGG + Intronic
905933573 1:41806687-41806709 TGCCCACTGGAGTGCCACAGAGG - Intronic
906193019 1:43910853-43910875 TGGCCAGAGGAGGACCACAGTGG - Intronic
908406263 1:63816951-63816973 TGGGCACTGGACTACAACAGAGG + Intronic
908459860 1:64338820-64338842 TGTCCACTCCTGAACCACAGTGG - Intergenic
911009309 1:93262608-93262630 TGTACCCTGCAGAACCACAGGGG - Intronic
912136240 1:106662950-106662972 TGTGCCCTGCAGAACCACAGGGG + Intergenic
915008071 1:152658912-152658934 TGTGCACTGGAGTGGCACTGCGG + Intergenic
915010606 1:152682503-152682525 TGTGCACTGGAGTGGCACTGTGG + Intergenic
918949697 1:191121172-191121194 TGAACACTGGAGAACCACTGTGG - Intergenic
919212900 1:194510909-194510931 TGTACACTGCAGACCCACAGTGG + Intergenic
921266419 1:213424522-213424544 TATCCCCTGGAGTAACACAAGGG - Intergenic
923172309 1:231429177-231429199 TGTACCCTGCAGAACCACAGGGG - Intergenic
1068266030 10:54651092-54651114 TGTAAACTGGAGTTCCACAAAGG + Intronic
1070630533 10:78081605-78081627 TGGCCACAGGAGGACCAGAGTGG + Intergenic
1072963458 10:99951504-99951526 TGTACCCTGGAGAGCCACAGGGG + Intronic
1073363071 10:102916136-102916158 TGTTCACTGCTGTATCACAGGGG - Intergenic
1076693160 10:132233966-132233988 TGTCCATAGTAGTTCCACAGTGG - Intronic
1076878300 10:133227630-133227652 TGTGCACTGCAGTGCCACTGTGG + Intergenic
1079649277 11:22906639-22906661 TGTCCACTGGTGTAACACAATGG - Intergenic
1080158166 11:29137803-29137825 TGAGCACTGGAGTGCCAAAGGGG + Intergenic
1081625389 11:44652282-44652304 TGTGCTTTGGAGTTCCACAGAGG + Intergenic
1084776775 11:71382211-71382233 TGTCCACTGAAGGTCAACAGGGG - Intergenic
1087175070 11:95089071-95089093 TAGGCACTGGATTACCACAGGGG - Intergenic
1087576902 11:100000478-100000500 TGTGCCCTGCAGAACCACAGGGG - Intronic
1088678770 11:112221754-112221776 TGTCCATTGGAGTACCTTATGGG + Intronic
1090607213 11:128433632-128433654 TGTCCACAGCAGGAGCACAGTGG - Intergenic
1090735515 11:129609410-129609432 TGTCCTCTAGAGTCCCTCAGAGG - Intergenic
1092381646 12:8001640-8001662 TATCCACTGAAGTAACACATTGG - Intergenic
1098076644 12:66738685-66738707 TGTCCCCTGGACTATCACTGGGG - Intronic
1098715153 12:73821133-73821155 TGTACCCTGCAGAACCACAGGGG - Intergenic
1100189213 12:92172834-92172856 TCTCCACTGGACTACCCCGGAGG + Intergenic
1101467065 12:104959024-104959046 TGTTCACTGGAGTATCCCTGGGG - Intergenic
1103250511 12:119496027-119496049 TGTCCACTGGAGTACCACAGTGG - Intronic
1105396806 13:20043898-20043920 TGACCACTGGAGACCCCCAGTGG - Intronic
1106614779 13:31316301-31316323 TGTCCCCTGCAGAGCCACAGGGG + Intronic
1112223244 13:97513152-97513174 TGCCCACTGGATTCCCCCAGTGG - Intergenic
1112827972 13:103413980-103414002 TCTCCACTTGAGTACCAAATGGG + Intergenic
1114795643 14:25712206-25712228 TGTACCCTGCAGAACCACAGGGG - Intergenic
1115864889 14:37734274-37734296 TATAAACTGGAATACCACAGGGG - Intronic
1116061544 14:39930542-39930564 TGACCACTGGAGTAGCGAAGTGG + Intergenic
1117637332 14:57757892-57757914 TGTCAACTGAAGAACCACAGGGG - Intronic
1121533257 14:94673355-94673377 TGTCCACTGAAGCCCCCCAGGGG + Intergenic
1122494218 14:102140301-102140323 TCTCCTCAGGAGTACCCCAGTGG - Intronic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1124370992 15:29104529-29104551 TGTCCACTGAAGCAGCTCAGCGG + Intronic
1129715437 15:77845750-77845772 TGTACCCTGCAGAACCACAGGGG + Intergenic
1130070598 15:80643908-80643930 TGTCCACTGAGGTACCACAAAGG + Intergenic
1131724612 15:95207639-95207661 TGTACCCTGCAGTGCCACAGGGG + Intergenic
1133320984 16:4913791-4913813 TCTCCACTGAAGACCCACAGTGG + Intronic
1138881694 16:61023837-61023859 TGTCCAATGTAATACCAGAGTGG - Intergenic
1139607776 16:68032252-68032274 TGTCCTCTTGGCTACCACAGTGG + Intronic
1140048560 16:71459184-71459206 TGTCCACAGGTGTCCCACATAGG - Intronic
1145847025 17:28048965-28048987 AATTCACTGGAGTAGCACAGAGG - Intronic
1148575929 17:48711258-48711280 TGTCCCCTGGAAGACCACATGGG + Intergenic
1150639763 17:66941672-66941694 TGTCCACTGTAGTTCCACACGGG - Intergenic
1151719509 17:75847355-75847377 TGACCCCTGGACTACCCCAGGGG - Intronic
1151929950 17:77225988-77226010 TGTCCACTGGAGTCCTACCCGGG + Intergenic
1156035534 18:32763041-32763063 TGTGCACTGAAGTACTAAAGGGG - Intronic
1156085385 18:33392994-33393016 TTTCCACTGGATTACCATGGGGG - Intronic
1156361751 18:36389907-36389929 TGGCCACTGGCCTACCACAGGGG - Intronic
1158833079 18:61302109-61302131 TGTCCACTAGAGTTGCACTGTGG - Intergenic
1162822550 19:13231847-13231869 TGTCCTCAGGAGTGCCACCGGGG - Exonic
1163035988 19:14569241-14569263 AGTCCACTGGAGTACCAATCGGG + Intronic
1163192104 19:15684892-15684914 TCTCCACTGTAGTCCCACACTGG - Intronic
925348370 2:3185557-3185579 AGTCCAGTGGAGAAGCACAGAGG - Intergenic
928826459 2:35427206-35427228 TTTCCACTGCAGTACGCCAGGGG + Intergenic
929088007 2:38187574-38187596 TGACCACTGGATTAGCACAATGG + Intergenic
929340239 2:40806690-40806712 TGTACACTGTAGAACAACAGAGG - Intergenic
929893946 2:45941774-45941796 GGTCCACTGGAGTCCCAGAGTGG + Intronic
930384109 2:50670922-50670944 TTTACAGTGGAGTAACACAGCGG - Intronic
932672702 2:73752183-73752205 TGTCCATTCAAGTCCCACAGTGG - Intergenic
932923355 2:75942275-75942297 TGTACCCTGCAGAACCACAGGGG + Intergenic
934518460 2:95004432-95004454 TGTCCCCTGGGGGACCGCAGTGG + Intergenic
935416252 2:102822273-102822295 TGTGCACTGGAGAACCAAACAGG + Intronic
944297965 2:198089128-198089150 TATTCATTGGAGTTCCACAGAGG - Intronic
944500580 2:200355170-200355192 TCTCCACAGCAGTGCCACAGTGG - Intronic
947148125 2:227087108-227087130 TCTCCAGGGGAGTACCCCAGTGG + Intronic
948913378 2:241017723-241017745 CGTCCACAGGAATCCCACAGCGG + Intronic
1172664303 20:36588610-36588632 TGTGCATTGGAGCACCATAGTGG + Intronic
1173268152 20:41505834-41505856 TCTCCACTTGAGTATCTCAGAGG + Intronic
1178126980 21:29526507-29526529 TGTACCCTGCAGAACCACAGGGG - Intronic
1178178527 21:30132641-30132663 TGTACCCTGGAGAACCACAGGGG - Intergenic
1181309240 22:21934984-21935006 AGTCCACAGGAGTGCCACGGTGG - Intronic
1184453540 22:44596818-44596840 TGCCCACTGCAGGCCCACAGCGG + Intergenic
1184974268 22:48049906-48049928 TGCCCGGTGGAGGACCACAGTGG - Intergenic
1185412165 22:50688500-50688522 TGCCCACTGGGGTCCCAGAGTGG + Intergenic
950740204 3:15044766-15044788 TGTCCAATGTGGCACCACAGGGG - Exonic
957676717 3:83377156-83377178 TGTACACTGCAAAACCACAGGGG - Intergenic
961931295 3:130536337-130536359 TGTTCATTCAAGTACCACAGTGG + Intergenic
967599536 3:191369225-191369247 TTTCCACGGGAGTACAAAAGAGG - Intronic
972213453 4:36866955-36866977 TGTGCACTTGTGTACCACACAGG + Intergenic
974556680 4:63460251-63460273 TGTACCCTGCAGAACCACAGGGG - Intergenic
976665524 4:87586769-87586791 AGACCAATGGAGTACAACAGAGG + Intergenic
976850186 4:89536143-89536165 TGTCCTCTGGATCCCCACAGAGG + Intergenic
978591634 4:110330197-110330219 TGTACCCTGCAGTGCCACAGGGG + Intergenic
979857042 4:125646648-125646670 TGTCCTCTGGAGGTCCAAAGAGG - Intergenic
981503052 4:145473157-145473179 TGTACACTGCAGAGCCACAGGGG - Intergenic
983844162 4:172495534-172495556 TGTCCTCTGGAGGACAAAAGCGG - Intronic
984690344 4:182719047-182719069 TGGCCACTGGAGGACCAGACAGG - Intronic
984699763 4:182811349-182811371 TGTACCCTGCAGAACCACAGGGG - Intergenic
987336454 5:16901757-16901779 TCTGCACTGGGGTAGCACAGAGG - Intronic
990727912 5:58776738-58776760 AGTCCATTGCAGTCCCACAGGGG + Intronic
993084551 5:83348075-83348097 TGTACCCTGGAGAGCCACAGGGG - Intronic
993334919 5:86645506-86645528 TGTACACTGCAAAACCACAGGGG + Intergenic
994137174 5:96301773-96301795 TGTACACTGCAGGGCCACAGGGG - Intergenic
996829120 5:127720423-127720445 TGTCCCCTGCAGAACCACAGGGG - Intergenic
1002202431 5:177537530-177537552 TGACCCCTGCAGCACCACAGAGG - Intronic
1006751140 6:36378021-36378043 TGTCACATGCAGTACCACAGAGG - Intronic
1007221014 6:40278868-40278890 TGTCCAGTTGAGAACCACAGGGG - Intergenic
1011955906 6:93025291-93025313 TGTACACTGCAGAGCCACAGGGG - Intergenic
1012617322 6:101293121-101293143 TGTACCCTGCAGAACCACAGAGG - Intergenic
1016605107 6:145911987-145912009 TTTCCAGTAGAGTACCCCAGTGG - Intronic
1018931411 6:168242494-168242516 TATACACTGGAGTTCCACACAGG - Intergenic
1020546660 7:9541291-9541313 TGTACCCTGCAGAACCACAGGGG + Intergenic
1021893761 7:25214150-25214172 TGTGCTCTGGAGCGCCACAGAGG - Intergenic
1022608747 7:31846286-31846308 TGTCCAATGGAATAGAACAGAGG + Intronic
1023736580 7:43240965-43240987 TGGCCACTTGAGTCCAACAGAGG + Intronic
1026779379 7:73254409-73254431 TGTCCACTCCAGTAGCAAAGGGG + Intergenic
1027020237 7:74807817-74807839 TGTCCACTCCAGTAGCAAAGGGG + Intronic
1027067789 7:75138123-75138145 TGTCCACTCCAGTAGCAAAGGGG - Intronic
1029528760 7:101111599-101111621 TGTCCCCTGTAGTACCACAGAGG + Intergenic
1031729945 7:125287813-125287835 TGTCCTCTGGATTATCTCAGGGG - Intergenic
1042501585 8:69514942-69514964 TGTACCCTGCAGAACCACAGAGG - Intronic
1047751116 8:127881328-127881350 TGTCCACTGGAGTTCATCTGCGG - Intergenic
1053266623 9:36719820-36719842 TGTCCACTGCAATACTCCAGGGG - Intergenic
1060758924 9:126232698-126232720 TGGCCACTGGAATCCAACAGTGG + Intergenic
1188146575 X:26621393-26621415 AGTGGACTGGAGTACCACAAAGG + Intergenic
1189649195 X:43171034-43171056 GGTCCACTGCGGTACCATAGTGG - Intergenic
1194067884 X:89284488-89284510 TGTCAACTGGAGAACACCAGTGG + Intergenic
1194435126 X:93860296-93860318 TGTACCCTGCAGTGCCACAGGGG + Intergenic
1196719473 X:118839891-118839913 TTTCCCCTGTAGTACCCCAGGGG + Intergenic
1196719474 X:118839894-118839916 CGTCCCCTGGGGTACTACAGGGG - Intergenic
1199271046 X:145883028-145883050 TGTACCCTGGTGTACCACTGGGG - Intergenic
1199306243 X:146270173-146270195 TGTACCCTGCAGTACCACAGGGG + Intergenic
1200722029 Y:6618649-6618671 TGTCAACTGGAGAACACCAGTGG + Intergenic