ID: 1103251347

View in Genome Browser
Species Human (GRCh38)
Location 12:119502681-119502703
Sequence AAGGAAGACACCCCTGGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103251347 Original CRISPR AAGGAAGACACCCCTGGATA TGG Intronic
900818559 1:4869210-4869232 AAGGCAGACACCCCCTGAGAGGG - Intergenic
905207683 1:36352170-36352192 AACGAGGACACCCCTGGTGAGGG - Intronic
907371502 1:54006507-54006529 AAGGAAGACTCCTCTGGTTCAGG + Intergenic
915955564 1:160217450-160217472 AAGAAAGACATCCCAGGAGAAGG - Exonic
916015822 1:160749156-160749178 ATGGAAGACACACCTGGATCAGG - Intronic
916152880 1:161812969-161812991 AATGATGACACCACTGGATTAGG - Intronic
917078174 1:171227767-171227789 GAGGAAGACTGCCCTTGATAGGG - Intergenic
918609397 1:186470324-186470346 CAGGAAGACAGCCATGGATTGGG + Intergenic
918854482 1:189733125-189733147 AAGGAAGACAATCTTGGAAATGG + Intergenic
1063168516 10:3485340-3485362 AAGGAAGACACTCATGGTAAAGG - Intergenic
1063559932 10:7116407-7116429 TGGAAAGACACCCCTAGATAGGG + Intergenic
1063710045 10:8468547-8468569 AAGGAAGAGACACATGCATAGGG - Intergenic
1064193482 10:13227205-13227227 AAGGAAACCACCCCTGGGTCAGG - Intronic
1064283517 10:13971841-13971863 AAAGAACACAGCCCTGGATGTGG - Intronic
1064331115 10:14395070-14395092 AAGGAAGACACCTTTGGGTGTGG - Intronic
1066225646 10:33380389-33380411 AAGAAAGGCTCCCCTGGGTAAGG + Intergenic
1066490024 10:35885307-35885329 AAGGATGACACAACTGGTTAGGG - Intergenic
1069130094 10:64689473-64689495 AAGGCAGAGACTCCTGCATAGGG - Intergenic
1069902133 10:71712520-71712542 AAGGAAGTCACCCCTTGCAAAGG + Exonic
1071966992 10:90861631-90861653 AAGGAAGCAACACCTTGATATGG - Intergenic
1072818340 10:98531435-98531457 CTGGAAGACACCCTTGGATGTGG - Intronic
1073607663 10:104912768-104912790 AAGGAAGAGATCCCAGAATAAGG + Intronic
1074543823 10:114387060-114387082 AAGGCAGACTCCCCTGGCCATGG - Intronic
1077318142 11:1928343-1928365 AAGGAAGCCACCCCTTATTAGGG + Intronic
1078760138 11:14245170-14245192 AAGGAAGACGCCCCAGGATAGGG + Intronic
1081583612 11:44369381-44369403 AAGGGAGACACCCTTGGAACTGG + Intergenic
1081894793 11:46576139-46576161 AAGGAAGACATCCCTGAGTATGG + Intronic
1084454355 11:69259060-69259082 AATGAAGAAGCCTCTGGATATGG - Intergenic
1084967345 11:72751629-72751651 AGGGAAGGCTCCCCAGGATATGG + Intronic
1086127775 11:83367194-83367216 AAGGAAGACACCCTTGCAAATGG + Intergenic
1087231910 11:95675705-95675727 AATGAACACACCACTGGATATGG - Intergenic
1088418692 11:109618669-109618691 AAGGAAGACGTCACTGGGTAAGG + Intergenic
1088987662 11:114924372-114924394 AAGGGAGAGACCCCTGAATGAGG + Intergenic
1091771073 12:3151650-3151672 AAGGAAGAAGACCCTGGAAATGG - Intronic
1092215042 12:6675630-6675652 GAGGAAGGCACCCCATGATATGG - Intronic
1093197589 12:16147012-16147034 AAGGAAAACAACCTTGGATTTGG - Intergenic
1096169703 12:49457850-49457872 ACAGAATATACCCCTGGATAGGG - Intronic
1100511523 12:95279494-95279516 AAGGAAAGCTCCTCTGGATAAGG - Intronic
1103049837 12:117769399-117769421 AAGGAAGATACCTCTGCATATGG + Intronic
1103251347 12:119502681-119502703 AAGGAAGACACCCCTGGATATGG + Intronic
1103408184 12:120690712-120690734 AAGGAAGGCAGCCCAGGAAAGGG - Intronic
1104263878 12:127212406-127212428 ATGGAAGACACCCCATGATATGG - Intergenic
1106003679 13:25749233-25749255 CAGGAAGACAGGCCTGGAAATGG + Intronic
1106085838 13:26540716-26540738 AAGGAAGAAAACCCTGGAATTGG - Intergenic
1106208929 13:27622914-27622936 GAGGAAGACAGCCCTGGAAATGG + Exonic
1106481844 13:30142859-30142881 AAACAAGACACCCATGGAAATGG - Intergenic
1107067500 13:36231040-36231062 AAGGAACACACGTCTGGAAAAGG + Intronic
1107549377 13:41460422-41460444 GAGGGAGACACACCAGGATAAGG + Intronic
1110456762 13:75697613-75697635 AAGGAAGACACTGCCTGATATGG - Intronic
1112996817 13:105584633-105584655 AATAAAGACACCCCTGCTTAGGG + Intergenic
1117783334 14:59257517-59257539 AAGGAAGACACCGCAGGCTGAGG + Intronic
1118450854 14:65900892-65900914 AGGGAAGTCACCCATGGTTATGG + Intergenic
1118882432 14:69841045-69841067 GAAGAAGAGACCACTGGATACGG - Intergenic
1118972578 14:70649615-70649637 AAGGAAGAAACCCCTAAAGATGG - Intronic
1122817404 14:104320507-104320529 AAGGAGGCCAGCCCTGGAAAGGG + Intergenic
1126819314 15:52486211-52486233 CAGGAAGAGACGCCTGGACATGG - Intronic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1131383419 15:91982900-91982922 AGGGAAGGCATCCCTGGAGAGGG - Intronic
1137730613 16:50686970-50686992 CAGTAAGTCACCCATGGATAGGG + Intergenic
1140249678 16:73285208-73285230 GAGGTAGACAACCCTGGATTAGG + Intergenic
1140301142 16:73758511-73758533 AAGCAAGACACACATGGACACGG + Intergenic
1141021561 16:80501628-80501650 AATGAAGACACCACTGCTTATGG + Intergenic
1141741729 16:85898299-85898321 AAGAAAGAAATCCCTGGAAACGG - Intergenic
1142872314 17:2828833-2828855 AGGGAAGTCACCTCTGGAGAGGG - Intronic
1143030014 17:3962713-3962735 AATGAAGACAGACCTGGCTAGGG + Intronic
1145869320 17:28260424-28260446 AAGGAAAACAGCTCTGGGTAGGG + Intergenic
1146287010 17:31581010-31581032 AAGGAACACAGCCCTGCATGGGG + Intergenic
1146938432 17:36826768-36826790 TGGGGAGACAGCCCTGGATATGG - Intergenic
1147011212 17:37449974-37449996 AAGATTGACACCCCTGGATTAGG - Intronic
1151184769 17:72355701-72355723 CAGGATGACACCCTTGTATATGG - Intergenic
1151405995 17:73886741-73886763 AAGGAAGACATCTCTGAAGAGGG - Intergenic
1152249074 17:79202161-79202183 GAGGAAGACACCCCGGGGTGTGG + Intronic
1152739327 17:82012146-82012168 AAGGAAGACAGGCCTGCAGATGG - Intronic
1157099556 18:44716854-44716876 AAGAATGACTCACCTGGATAAGG - Intronic
1158215968 18:55101214-55101236 AAAGTAGAGAGCCCTGGATAGGG + Intergenic
1158340365 18:56459535-56459557 AAGAAAGGAACCCCTGGAAAGGG - Intergenic
1160428317 18:78793469-78793491 AAGGAAGCCCCCGCTGGAGATGG - Intergenic
1160499352 18:79394561-79394583 CAGGTAGAGACCCCTGGAAATGG + Intergenic
1162446225 19:10724537-10724559 GAGGAAGGAACCCCTGGAGACGG + Intronic
1165309966 19:35023852-35023874 AATGAAGCCAACCCTGGAGATGG - Intronic
1166341122 19:42137839-42137861 AAGGAAGACACTCCAGGCAATGG + Intronic
1166420033 19:42629784-42629806 GAGGAAGAGAACCCTGGATGGGG + Intronic
1166991627 19:46696298-46696320 AATGAAGACTCCCCTGGCTGTGG + Intronic
1167685352 19:50952628-50952650 CAGCAAGACCCCCCTGGATGTGG - Exonic
925570743 2:5310164-5310186 AGGGAAGACAACACTTGATATGG + Intergenic
926651571 2:15352471-15352493 AAGGAAGATACACCTGGAAGAGG + Intronic
927040560 2:19226488-19226510 AAGGAAGCCACCCCTGGAGGAGG + Intergenic
927406125 2:22769763-22769785 AAGGAAGAGACTCCGGGAGATGG + Intergenic
929473332 2:42219172-42219194 AAGGAAGAGCCCCCTTCATAAGG + Intronic
934954612 2:98607298-98607320 AAGGGACACAGCCCTGGACAGGG + Intronic
937316527 2:120935264-120935286 AAGGAAGAGCTCCCTGGAGATGG - Intronic
938464746 2:131518382-131518404 CAGGAGGACACCCCTGGGTCAGG + Intergenic
945961569 2:216140692-216140714 CAGGAAGACACCATTGGATCAGG - Intronic
947972740 2:234337583-234337605 AAGGAAGGCACCCCTAGCAAGGG + Intergenic
1169941059 20:10938117-10938139 AAGGAAGACAAGCCTGTGTAGGG + Intergenic
1171418223 20:24998236-24998258 CAGGGAGCCACCCCTGGCTATGG - Intergenic
1173460213 20:43237253-43237275 AAATCAGACACCCCTGGATTTGG + Intergenic
1175816854 20:61887625-61887647 ATGGAAGCCACCCCTGGCTGTGG - Intronic
1176657979 21:9605112-9605134 ATGGAAGACACCACTTGATGTGG + Intergenic
1179604480 21:42504943-42504965 AAGGAAGACTCTCCAGGATTTGG - Intronic
1180939046 22:19644943-19644965 CAGGAAGACACCCCTGGGGAGGG - Intergenic
1183369515 22:37424614-37424636 AAGGAAGGTACCCCTCGAGAAGG + Intronic
1185062147 22:48612637-48612659 AAGGGAGACACTCCGGGAAAGGG - Intronic
950964935 3:17139544-17139566 AAGGAAGTCTCCCCTGGCCAAGG + Intergenic
953380562 3:42468691-42468713 AAATTAGACACCCCTGGATATGG - Intergenic
953755193 3:45640120-45640142 AAGGAAGACAGACCTGGTTTGGG + Intronic
955628496 3:60946764-60946786 AAAACAGACACCCCTGGAGAGGG + Intronic
956885052 3:73550669-73550691 AATGAAGGCACACCTGTATATGG + Intronic
959568175 3:107853892-107853914 CAGGAAGAAATCCCTGGATGAGG + Intergenic
960595608 3:119405387-119405409 AAGGACAACACCCCTGGGTATGG - Intronic
961424225 3:126832347-126832369 ATGGACACCACCCCTGGATAAGG - Intronic
962371945 3:134828071-134828093 AAGGAAGCCACCCATGGACCAGG - Intronic
962446644 3:135471923-135471945 AACTGAAACACCCCTGGATATGG + Intergenic
964308010 3:155361586-155361608 AGGCAAGAAACCCCAGGATATGG - Intergenic
966763885 3:183441311-183441333 AAGGAAGACACCCTTACAAATGG - Intergenic
967784879 3:193481725-193481747 AAGGAAGCAACCCCAGGTTATGG + Intronic
968229302 3:196995949-196995971 AAGGAATCCACACCAGGATAGGG + Intronic
968733193 4:2281326-2281348 AAGGAAGACACCCATCCACATGG - Intronic
969680340 4:8639826-8639848 AGGGGAGCCACCCCTGGAAATGG + Intergenic
969989262 4:11243741-11243763 CAGGAAGACAGCCCTAGATCAGG + Intergenic
970083947 4:12324099-12324121 AAGGAACACAGCCCTTCATAAGG - Intergenic
973792697 4:54393094-54393116 AAGGAAGATAACCGTGGAAAAGG - Intergenic
977835529 4:101641559-101641581 AGGGTAGCCACCCCTGGGTAGGG + Intronic
978040354 4:104053222-104053244 AAGGAAGACTAGCCTGGATAAGG - Intergenic
980687832 4:136253516-136253538 GAGGGAGACTCCCCTGGAAAGGG + Intergenic
980904576 4:138935072-138935094 TAGGAAGAAACCCCTGGTTGGGG - Intergenic
982233826 4:153233596-153233618 AAGGAAGAAACCCATGGGAAAGG + Intronic
984421237 4:179524707-179524729 AAGGAAGACACACTTGATTAAGG - Intergenic
985245158 4:187972995-187973017 AAGCAAGAGACACCTGGATGAGG + Intergenic
985417431 4:189750961-189750983 ATGGAAGACACCACTTGATGTGG - Intergenic
986752607 5:10802418-10802440 TAGGACAACAGCCCTGGATAAGG + Intergenic
994836967 5:104867183-104867205 AAGGCAGCCACCCCTTAATAGGG + Intergenic
1000033543 5:157424340-157424362 AAGAAAGACATACATGGATATGG + Intronic
1001315516 5:170638725-170638747 AAGGAAGACACCACTTTATGTGG - Intronic
1001805059 5:174577072-174577094 AAGGAAGAAACCCATGCATAAGG + Intergenic
1002074605 5:176700634-176700656 AAGATTGACAGCCCTGGATAGGG - Intergenic
1002825663 6:771430-771452 AAGGAAAACACTCCTCTATAAGG - Intergenic
1003073041 6:2959621-2959643 AAGGAAGAGACTCCAGGAAAGGG - Exonic
1005255588 6:23999447-23999469 AAGGTAGACACACCTGGCTGTGG + Intergenic
1008517940 6:52335734-52335756 AAGGAGGACAGCCCTGGAACTGG + Intergenic
1010163566 6:72888749-72888771 AAGTAAGACACCCCTATATTTGG - Intronic
1011823979 6:91284991-91285013 AAGGGAGACATCCCTGTTTATGG + Intergenic
1013662182 6:112308921-112308943 AAAGACTACACCCCTGGCTAGGG + Intergenic
1014073060 6:117205122-117205144 AAGGAAGACACCCCACAATGTGG + Intergenic
1014191773 6:118504489-118504511 AAGGGTGGCACCCCTGGAGATGG + Intronic
1019997128 7:4731808-4731830 AAGGAAAACAGCCCAGGATAAGG - Intronic
1021830972 7:24609397-24609419 AAGGAAGAGTACTCTGGATATGG + Intronic
1021841081 7:24722445-24722467 AAGGAAGAGACCATTGGAAAGGG - Intronic
1026271015 7:68836918-68836940 GATGAAGACATCCCTGGAAAGGG - Intergenic
1026977959 7:74510099-74510121 GTGGGAGACACCCCTGGAAAAGG + Intronic
1029378236 7:100195349-100195371 AACAAAGACACCCCTGAAGAGGG - Exonic
1029564888 7:101330091-101330113 AAGGAAGACACGCTTGGGTGTGG + Intergenic
1030304777 7:108006533-108006555 AAGTGATGCACCCCTGGATATGG - Intergenic
1033026127 7:137774600-137774622 AGGAAAAACACCCCTGGATGGGG - Intronic
1033416675 7:141167756-141167778 AAGGAATGCAGCCCTGGACAGGG + Intronic
1033599022 7:142875982-142876004 GAGGACGGCACCCCTGGAGAAGG + Intronic
1033968277 7:147005743-147005765 AAGGAAGCCACCCTTGCAAATGG + Intronic
1036006379 8:4668759-4668781 AAGGAAGAGAACACTGGAAATGG - Intronic
1036776705 8:11617793-11617815 TAGAAAAACACCACTGGATAAGG + Intergenic
1039389447 8:37165648-37165670 AAGGATGACATTCCTGGGTAGGG + Intergenic
1041777482 8:61539436-61539458 AAGGAAAGCACACCTGGATGAGG + Intronic
1042373698 8:68022490-68022512 AAGGAAGAAAATCGTGGATATGG + Intronic
1048910925 8:139134280-139134302 AAAGAAGAAACGCCTGGATTTGG - Intergenic
1050969446 9:11850543-11850565 AAGCAATCCACCGCTGGATATGG - Intergenic
1051761970 9:20477549-20477571 AAGGATGACAAAACTGGATAGGG + Intronic
1054741760 9:68813131-68813153 AAGGAAGACATTTCTGGACATGG + Intronic
1055891242 9:81126301-81126323 GAGGAAGACACCTCTGTACACGG + Intergenic
1056123094 9:83508937-83508959 AAGGAAGACTTCCCTGGGAATGG - Intronic
1056210156 9:84357812-84357834 AAGGCAGAAAGCCCTGGATTGGG - Intergenic
1057520005 9:95752531-95752553 AAGCAAGACACCCCGGGGCAGGG + Intergenic
1058095702 9:100857877-100857899 AAGGCAGAGACACCAGGATATGG + Intergenic
1058931017 9:109718852-109718874 AAGGAAAACACCATTGGAAAAGG - Intronic
1059550948 9:115228276-115228298 AAAGAAGATAGCTCTGGATATGG - Intronic
1203635708 Un_KI270750v1:108687-108709 ATGGAAGACACCACTTGATGTGG + Intergenic
1193191544 X:78577198-78577220 AAGGCAGCCACACCTAGATATGG + Intergenic
1195319168 X:103707305-103707327 AGGGAAGACAGCCCGGGAGATGG + Exonic
1199118913 X:144028205-144028227 AAGTAATAAACCCCTGGACAGGG + Intergenic
1199146867 X:144379255-144379277 AAGGGTGACAGCCCAGGATAGGG + Intergenic