ID: 1103251774

View in Genome Browser
Species Human (GRCh38)
Location 12:119506139-119506161
Sequence CTCTGGGTAAGAAGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 319}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103251774 Original CRISPR CTCTGGGTAAGAAGGGCAGA AGG (reversed) Intronic
900512327 1:3066617-3066639 CCCTAGGGAAGAAGGGCAGGAGG - Intergenic
901718381 1:11175291-11175313 ATCTGGGTATCAGGGGCAGAAGG + Intronic
902368081 1:15990298-15990320 CTGTGGGTACCAAGGGCAGCTGG - Intergenic
902375370 1:16027800-16027822 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902380334 1:16049597-16049619 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902918420 1:19652489-19652511 CACTGGGGAGGAAGGGCAGCTGG - Intronic
903366209 1:22806900-22806922 CTCTGGGGAAGTAGGGCTGGGGG - Intronic
904621297 1:31776884-31776906 ATCTGGGGAGGCAGGGCAGAGGG + Intergenic
904924913 1:34039809-34039831 CCCTGGGTAATTAGGGCAGGGGG + Intronic
905007732 1:34723844-34723866 CTCTGGGTAAGAGGGTTACAGGG + Intronic
905203037 1:36326651-36326673 CTGTGGGCAAGAAGGGGAGCAGG + Intronic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905878236 1:41447188-41447210 TTCTGGGGAAGGAGAGCAGAAGG - Intergenic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907495732 1:54843097-54843119 CCCTGGGGAAGGAGGGCACAGGG - Intergenic
907774573 1:57501233-57501255 CTCCTTGTAAGAAGGCCAGAAGG + Intronic
908457314 1:64316254-64316276 TTCTGTGTAGAAAGGGCAGAGGG + Intergenic
909596710 1:77413864-77413886 CTCTGGGTGAGAAGGGGAAGTGG - Intronic
909775125 1:79474878-79474900 CTCAGGGTATGAAGGTCAAACGG + Intergenic
910631658 1:89361943-89361965 CTTTCGGTGAGTAGGGCAGATGG - Intergenic
910640584 1:89457185-89457207 CTTTGGGTGAGTAGGGCAGATGG + Intergenic
911360865 1:96873914-96873936 CCCAGGGTGACAAGGGCAGAGGG + Intergenic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912967361 1:114248308-114248330 GTCTGGGGAAGAAGGAAAGAAGG - Intergenic
914513765 1:148356065-148356087 CTTTGGGGAAGAAGGGCAGGGGG - Intergenic
915658002 1:157377474-157377496 CTCTGGGGAAGAATGGGGGAGGG + Intergenic
915673451 1:157509730-157509752 CTCTGCGTGGGAAGGGAAGAAGG - Intergenic
916193732 1:162203841-162203863 CTTTGGTCAAGAAGGCCAGATGG + Intronic
916962051 1:169898372-169898394 CTATGCATAAGAAAGGCAGAAGG - Intergenic
917998953 1:180472418-180472440 CTCTGGATAATAAAGCCAGAGGG + Intronic
918743677 1:188170457-188170479 CTCTGGGAAACAAGGAAAGATGG + Intergenic
919751034 1:201038381-201038403 CACTGGGTCAGAAGGGAAGGAGG + Intergenic
919787699 1:201270276-201270298 CTCTGAAAACGAAGGGCAGAGGG + Intergenic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
921092852 1:211859679-211859701 CTATGGGTAGGAAAAGCAGAGGG + Intergenic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
922332820 1:224592679-224592701 CTATGCTTTAGAAGGGCAGAGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923454427 1:234151016-234151038 CTCAGGGCAAGAAGGACTGAAGG + Intronic
924411050 1:243806065-243806087 TTTTGGGTGAGAAGGGAAGAAGG - Intronic
924481889 1:244442990-244443012 CTATGTATTAGAAGGGCAGATGG + Intronic
1063364372 10:5480837-5480859 TTCTGAGTAAGAACGGGAGATGG - Intergenic
1064644319 10:17445523-17445545 CTTTGGAAAAGAAAGGCAGACGG - Intronic
1064717154 10:18188315-18188337 CTCTGGGAAGGAAGGCAAGAAGG - Intronic
1066220737 10:33335049-33335071 CTCTGGGAAAGACAGACAGACGG - Intronic
1068550713 10:58404837-58404859 CCTTGGGAAAGAAAGGCAGAAGG - Intergenic
1068913850 10:62407234-62407256 CTATGGGGAAGCAGGTCAGAGGG - Intronic
1069506289 10:69001185-69001207 CTCTGGTTAAGCAGGTTAGAAGG + Intronic
1070483727 10:76910235-76910257 CTTTGGGTAAGGGGGGCAGTGGG + Intronic
1070490730 10:76973949-76973971 CACTGGGGAAACAGGGCAGAGGG - Intronic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1072263282 10:93702670-93702692 CTCCGGGAAACAAGGGCAGCGGG + Intergenic
1072788874 10:98303269-98303291 CTCTGGGGAACAAGGGCACAGGG + Intergenic
1073207969 10:101778688-101778710 CTCTGGGGGAGAGGAGCAGATGG + Intronic
1073253268 10:102134653-102134675 CTCTGAGAAAGTAGGGGAGAAGG - Intronic
1073457107 10:103644228-103644250 CTAAGGGTAAGTAGGGCAGGTGG - Intronic
1074437194 10:113444254-113444276 CAGTGGGAAAGAAGGACAGAGGG - Intergenic
1076192829 10:128494980-128495002 TTCTGGGTAAGCAGAGCAGAGGG - Intergenic
1076629663 10:131844664-131844686 CCCTGGCTAAGATGGGCAGGTGG + Intergenic
1076857933 10:133126755-133126777 CTCAGGGGAAGAAGGTCGGAGGG - Intronic
1076919582 10:133444770-133444792 GTCTAGGTGAGGAGGGCAGAGGG - Intergenic
1077066563 11:643679-643701 CTCTTGGTCAGGAGGGCAGGGGG + Intergenic
1079012034 11:16836486-16836508 CTCTGGGTGAGAATCACAGAGGG + Intronic
1079523334 11:21354924-21354946 CCCCAGGTAAGAAGGTCAGAAGG - Intronic
1080448202 11:32356677-32356699 CTCTGGGTCAGATGGGAAGACGG - Intergenic
1083593875 11:63909948-63909970 CTCTGGGGAGGAGGGGCAGAGGG - Exonic
1083856647 11:65396367-65396389 CCCCGGGTCAGACGGGCAGAGGG + Intronic
1083989532 11:66238352-66238374 CTCTGGGGATAAAGGGCTGAAGG - Intronic
1084075339 11:66770797-66770819 CGATGGGTAAGGAGGCCAGAAGG - Intronic
1084238197 11:67801640-67801662 CACTTGGAAAGGAGGGCAGAGGG + Intergenic
1084678182 11:70649114-70649136 ATATGGGTGAGAAGGGGAGATGG - Intronic
1084834213 11:71791194-71791216 CACTTGGAAAGGAGGGCAGAGGG - Intronic
1085220926 11:74873149-74873171 CTCTGGTTAAGAAAAGCAGTGGG - Intronic
1085512060 11:77093448-77093470 CTCTGGCCAGGAAGGGGAGAGGG + Intronic
1086917488 11:92547625-92547647 CTGGGGGTGAGAAGGGGAGAGGG - Intronic
1091840629 12:3617908-3617930 GGCTGGGTGAAAAGGGCAGAGGG - Intronic
1091996675 12:4999253-4999275 CTCTGGGGAAGAAGCACAGGTGG + Intergenic
1093253991 12:16842824-16842846 CCCTGGGTAAGCAGGGAAGCAGG + Intergenic
1093261978 12:16950166-16950188 CTCTGCCCAAGAGGGGCAGAGGG + Intergenic
1094124623 12:27010801-27010823 TTCTGGGTAAGAATGGAAGATGG - Intronic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1094410984 12:30168981-30169003 CTCTGAGTAAGAATTACAGAGGG - Intergenic
1095844363 12:46729707-46729729 CTCGGGGACAGAAGGGCAGGTGG + Intergenic
1096521887 12:52189146-52189168 CTCTGGGTAAAGAGAGGAGAGGG - Intronic
1096845226 12:54402966-54402988 GTTTGGGTAAGTAGGGCTGACGG - Exonic
1101360314 12:104020264-104020286 TTCTGGGTCAGCAGAGCAGATGG + Intronic
1101465503 12:104944759-104944781 ATCTGGGAAAGAAGGGTAGTTGG - Intronic
1102611213 12:114114026-114114048 CTGAGGCTTAGAAGGGCAGAGGG - Intergenic
1102612509 12:114124852-114124874 CTGAGGCTCAGAAGGGCAGATGG - Intergenic
1102797349 12:115700344-115700366 ATCTGTGTGGGAAGGGCAGAAGG - Intergenic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1106133969 13:26960850-26960872 CTCTGGGGAAGATTGGCAGCAGG + Intergenic
1110591928 13:77273156-77273178 CTCAGGGAAAGATGGGAAGAAGG + Intronic
1111317090 13:86577508-86577530 CTCTGGGTTAGAATGACAGAAGG - Intergenic
1112412145 13:99173690-99173712 CTCTGGGTGAAAAGAACAGAAGG + Intergenic
1112686323 13:101832103-101832125 CTCCTCGTAAGAAAGGCAGAGGG + Intronic
1114531211 14:23397526-23397548 CACCGGGTAAGAAGGGCCCAGGG - Exonic
1117049466 14:51845779-51845801 CGCAGGGTAAAAAGTGCAGATGG - Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1119999484 14:79286200-79286222 GTCTGGGTCAGAAGGGTAGCAGG - Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120862456 14:89267067-89267089 CTGTAGGGAAGAAGGGAAGAAGG - Intronic
1122316776 14:100830111-100830133 CTCTGGGCCAGAGGGGAAGAAGG - Intergenic
1125502579 15:40248654-40248676 CACTGGGTGTGAGGGGCAGAGGG - Intronic
1126119913 15:45242344-45242366 CTATGGGTAAGTAGGGCACTTGG - Intergenic
1126142591 15:45450224-45450246 CTGTGGATGAGAAGGGCAGGTGG + Intergenic
1127290115 15:57562522-57562544 CGCTGGGTAATAAGGGAAGCAGG - Intergenic
1128185463 15:65640400-65640422 CTCTGGGGAAGAGAAGCAGAAGG - Intronic
1129385704 15:75195255-75195277 CTCAGGGCAAGAAGGCCACAGGG + Intergenic
1129694189 15:77731274-77731296 CTCTGGGAAACTAGGGCAGTGGG - Intronic
1131359223 15:91774722-91774744 CTCTGGGTATGAAGTCCAGTGGG + Intergenic
1132397560 15:101485746-101485768 CTCTGGGAAAGAAGAGGAGGAGG - Intronic
1133349843 16:5094087-5094109 CACTTGGAAAGGAGGGCAGAGGG + Intronic
1133434217 16:5765443-5765465 CTCTGGGAAAGAAGGGTCAAAGG - Intergenic
1135424323 16:22324789-22324811 ATCTGGGTGTGAAGGGCAGGTGG + Intronic
1135943086 16:26839856-26839878 CTCTGGGAAGTTAGGGCAGAGGG + Intergenic
1136284592 16:29233570-29233592 CTCAGAGCAGGAAGGGCAGAGGG + Intergenic
1136284605 16:29233615-29233637 CTCGGAGTGGGAAGGGCAGACGG + Intergenic
1138930906 16:61654762-61654784 CACTGGGTGAGAAAGACAGATGG + Intronic
1138973199 16:62170979-62171001 CTTGGGGTCACAAGGGCAGAGGG + Intergenic
1139012273 16:62647782-62647804 CCCAGGGGAAGAATGGCAGATGG + Intergenic
1139310257 16:66022079-66022101 CTCTGGTTCAGAAGGTCAGGGGG - Intergenic
1139434605 16:66928770-66928792 CTCTGGGCAATAGGGGCTGATGG + Intergenic
1139666386 16:68459775-68459797 TTCTGGGTCCCAAGGGCAGAGGG - Intergenic
1139973337 16:70790140-70790162 CACTTGGTAAGAAGGGCATGAGG + Intronic
1141253776 16:82382352-82382374 CACTGGGTAAGAACAGCACAGGG + Intergenic
1141312717 16:82930778-82930800 CCCTAGGTGAGAAGGGCAGTGGG + Intronic
1141769101 16:86078124-86078146 CTCTGGGAAGGGAAGGCAGAGGG - Intergenic
1142089624 16:88203083-88203105 CTCAGAGCAGGAAGGGCAGAAGG + Intergenic
1142919251 17:3170078-3170100 TTCTGGTTAAGAAAAGCAGAGGG + Intergenic
1142998185 17:3773727-3773749 TTCTGGGAGAGAAGGGCTGAAGG - Intronic
1143272028 17:5682985-5683007 CTCTGGTCAAGAAGAGCTGAAGG + Intergenic
1144034845 17:11355762-11355784 ATCTGGGATAGAAAGGCAGATGG + Intronic
1144379163 17:14675925-14675947 CTCTGGATAAGAAGGGTAAGGGG + Intergenic
1144638817 17:16926648-16926670 CTCTGGCTAAGCAGGGCTAAGGG - Intergenic
1145208110 17:20995310-20995332 CTCTGGCTAAGCAGGGCTAAGGG + Intergenic
1145282057 17:21475386-21475408 CTCTGGGTAGGCTAGGCAGAGGG - Intergenic
1146264756 17:31445016-31445038 CTCTGGGTTAGCAGGGCCTATGG + Intronic
1146285052 17:31568669-31568691 CTTGGGGTAAGAAGGCAAGAGGG - Intergenic
1146615711 17:34355789-34355811 CTCTGGGCCTGAGGGGCAGAAGG + Intergenic
1146709998 17:35032721-35032743 GTCTGGGTCAGAAGAGAAGAAGG + Intronic
1146883445 17:36456125-36456147 CTTTGGGAAGGAAGGACAGAAGG + Intergenic
1147615313 17:41823874-41823896 CCCTGGGCAAGAAGTGCTGATGG - Intergenic
1148235181 17:45964002-45964024 CTCTGGGTGAGGAGGTGAGAGGG + Intronic
1148246449 17:46034082-46034104 CTCTTGGTCAGAAGAGAAGAGGG + Intronic
1148485971 17:47991268-47991290 CTCTGGTTGAGAAAGGCAGGCGG + Intergenic
1150810564 17:68353590-68353612 CGGTGGGTAAGAAGGGCAGCAGG - Intronic
1150920155 17:69474543-69474565 CGCAGGGTAAGAAGGAGAGAGGG - Intronic
1151133495 17:71922832-71922854 CTATAGGTAAGAAGGACTGAGGG - Intergenic
1151660581 17:75516176-75516198 GGCTGGGCAAGGAGGGCAGAAGG - Intronic
1151674904 17:75592337-75592359 CCCAGAGTAGGAAGGGCAGAGGG + Intergenic
1152033228 17:77856531-77856553 CTCTGGGGAGGAGGGGCAGCTGG - Intergenic
1152255574 17:79237498-79237520 CTGTGGGTGAGACAGGCAGATGG - Intronic
1153014818 18:573968-573990 ATCTGGGAAAGAAGGGGAGAGGG + Intergenic
1153103206 18:1497650-1497672 CCCTGGGTCACAAGGGCAGAGGG + Intergenic
1153912636 18:9717629-9717651 CTCTGGGAGGGAAGGACAGAGGG + Intronic
1156454717 18:37286549-37286571 CTGTGGGTCAGAGGGGCAGGGGG - Intronic
1156522628 18:37734649-37734671 CTCAGGGAAAGAAGAACAGAGGG - Intergenic
1157639679 18:49202035-49202057 TGTTGGGTAAGAAGGGAAGATGG - Intronic
1160244396 18:77145497-77145519 CTCTGAGGAAGCAGGACAGATGG - Intergenic
1160627716 18:80223988-80224010 GGCTGGGTAAGGAGGACAGAGGG + Intronic
1162494314 19:11014593-11014615 TCCAGGGGAAGAAGGGCAGAGGG - Intronic
1163319247 19:16563368-16563390 CTGTGTGTAATAAGGACAGAGGG + Intronic
1164782530 19:30905055-30905077 GTCTGGGTAACACTGGCAGATGG - Intergenic
1164980655 19:32611314-32611336 CACAGGATAAGAAAGGCAGATGG - Intronic
1166371504 19:42303822-42303844 CTCTGGGGAGGAAGAGGAGAAGG + Intronic
1166438862 19:42792990-42793012 CTCTGGGTAACAATGAAAGAAGG - Intronic
1167080085 19:47272209-47272231 CTCTGGGGCTGAGGGGCAGAGGG + Intergenic
1167267308 19:48489989-48490011 CTCTGGGAGAGCAGGGCACACGG - Intronic
926232992 2:11018942-11018964 CTCGGGAAAAAAAGGGCAGAGGG + Intergenic
928651557 2:33409543-33409565 CTGTGGGTAACAAAGGCAAAAGG - Intergenic
928796796 2:35033161-35033183 CAGTGGGTAAGAGGGGCAGAGGG + Intergenic
929067749 2:37996951-37996973 CTCTGGGTCAGGAGGCCAGTTGG + Intronic
929673126 2:43895236-43895258 CTCTTGGTGAGATGGGAAGAGGG - Intronic
929947511 2:46381952-46381974 CTGGGAGTAAGAAGGGCAGATGG - Intronic
933170527 2:79120213-79120235 CTCTGGGTTATTAGGGCACATGG + Intergenic
934076139 2:88430171-88430193 CGCTGGGTTATCAGGGCAGAGGG - Intergenic
936386275 2:112032418-112032440 CCCTGTGTAAGAAGGGGAGGAGG + Intergenic
937018688 2:118630956-118630978 CTCCAGGGAAGAAGGGAAGAAGG + Intergenic
937593831 2:123648662-123648684 CTATAGGTAGGAAGAGCAGATGG + Intergenic
941180047 2:162248563-162248585 CTGAGGGTAAGAAAGGGAGATGG + Intergenic
941919801 2:170839112-170839134 GTCTGGGAAAGAATGGCAAAAGG + Intronic
944944891 2:204672388-204672410 CACTGGACATGAAGGGCAGATGG + Intronic
945532211 2:210969816-210969838 CTCTGGGGAAGAAAGAGAGAAGG - Intergenic
945689809 2:213019700-213019722 CACTGGGTAGGTAGAGCAGAGGG - Intronic
946543055 2:220706962-220706984 CTCTGGGAGGAAAGGGCAGAGGG - Intergenic
946967726 2:225055642-225055664 CCCTAGGTCAGAAGGGCAGTGGG - Intergenic
947866341 2:233400411-233400433 CACTGGGTGTGAAGGGCAAAGGG - Intronic
948341543 2:237256650-237256672 GTCTGGGAAAGGAGGGCAGTTGG - Intergenic
948428719 2:237904828-237904850 CTCTGGGTAAGAGGTGGAGCTGG + Intronic
948544521 2:238717343-238717365 CTCTGGATGGGAAGGACAGACGG + Intergenic
948741434 2:240049027-240049049 CTCTGGGTCAGCAGGGAGGAGGG + Intergenic
948833363 2:240611800-240611822 CTCTAGGGGTGAAGGGCAGAGGG + Intronic
1169628621 20:7600348-7600370 CTCTGCTTAAGAAAAGCAGAGGG + Intergenic
1170421397 20:16196935-16196957 CTCTGGGTAAGAAGGACTCCAGG + Intergenic
1171188263 20:23138906-23138928 CCCTGGGTAAGGAGGGAAGCCGG + Intergenic
1173000158 20:39099663-39099685 CTCAGGCCAAGAAGGGCAGTGGG - Intergenic
1173062169 20:39672944-39672966 CCCTGGGTAAGACCAGCAGAAGG + Intergenic
1173476549 20:43363909-43363931 CTCCGGGTGAGATGGGAAGAAGG - Intergenic
1173672777 20:44809986-44810008 CCCTGGGGGAGAAGGCCAGAAGG + Intronic
1174554577 20:51384519-51384541 CTCATGGTATTAAGGGCAGAGGG + Intergenic
1174716273 20:52762147-52762169 CTTTGGGGAAGAAAGGCACAAGG - Intergenic
1174985664 20:55448738-55448760 CTCTGGATAAGAAGAAGAGAGGG - Intergenic
1175013836 20:55766969-55766991 CTCTGGGGCAGAGGAGCAGAGGG - Intergenic
1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1178773939 21:35531054-35531076 TTCTCGGTGGGAAGGGCAGAGGG + Intronic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179499814 21:41801201-41801223 CTCGGGGCAAGAACTGCAGAGGG - Exonic
1180068807 21:45425885-45425907 CTTTGGGCAAGAAGGACAGCCGG - Intronic
1180699307 22:17773132-17773154 CCCTGGGCAAGAGGGGCAGAAGG + Intronic
1182585180 22:31340919-31340941 ATCTGAGTGGGAAGGGCAGAGGG + Intronic
1182595978 22:31420776-31420798 CTCTGGGCAGGAATGGAAGAGGG + Intronic
1182617448 22:31597267-31597289 CTCTGGAGAAAAAGGGCAGAGGG + Intronic
1182735677 22:32530965-32530987 CTATTTGTAAGAAGAGCAGAAGG + Intronic
1183540850 22:38428514-38428536 CTCAGGGCAAGCAGGACAGAGGG - Intronic
1183646680 22:39131289-39131311 CTGGGGGAAAGAAAGGCAGATGG + Exonic
1184162350 22:42704541-42704563 CTGTTTGTAAGAAGGGCAGAAGG + Intronic
1184352814 22:43955632-43955654 CTCTGGGCCAGCAGGGCAGACGG + Intronic
1185109238 22:48891648-48891670 CTCTGAGGAAGAAGAGCAGTGGG + Intergenic
950117367 3:10460109-10460131 CTCTGGGAATGAAGTGCTGATGG + Intronic
951281503 3:20755719-20755741 CTGTGGATAAGATGGGCATAAGG - Intergenic
954331949 3:49895917-49895939 CCCTGGGAAACACGGGCAGAGGG - Intronic
954393189 3:50278231-50278253 CACTGGGAAGGAAGGGCACAGGG + Intergenic
954487181 3:50863405-50863427 CTCTGGGTTACAAGGGCAGAGGG + Intronic
954661638 3:52229823-52229845 CTCTGGGTGCGAAGGTCAGCAGG - Intronic
954673794 3:52304675-52304697 CTCCAGTTCAGAAGGGCAGAGGG + Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957054144 3:75431437-75431459 CCCTTGGAAAGGAGGGCAGAGGG + Intergenic
957497266 3:81008015-81008037 GTCTGGGCAAGAAAGGCAGCTGG + Intergenic
957803870 3:85121146-85121168 CTCAGGGTAATAAAGGCAGAGGG + Intronic
958949534 3:100401317-100401339 CTTCAGGAAAGAAGGGCAGATGG + Exonic
959849957 3:111073178-111073200 CTCTTGGTAAGAAAAGTAGAGGG + Intronic
960966812 3:123111231-123111253 CTCTGGATAAAGAGGGTAGAAGG - Intronic
961300694 3:125920276-125920298 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
962015755 3:131438731-131438753 CTCGGTCTAAGATGGGCAGAGGG - Intergenic
962258617 3:133888576-133888598 CTCTTGGTAACAAGGCCAGAGGG - Intronic
963371289 3:144403874-144403896 CTCTGGGTAAGAAGTGAATATGG + Intergenic
963850359 3:150204847-150204869 CTCAGAGTAGGAAGGGCAGTTGG - Intergenic
966154516 3:176901574-176901596 ATGTAGGTAAGAAGGGGAGAAGG + Intergenic
967156666 3:186698661-186698683 CCCTGAGTGAGAAGAGCAGATGG - Intergenic
968441551 4:626916-626938 CTCTGAGGAAGAAGGGGAGGGGG + Intronic
969549504 4:7855374-7855396 TTCTGGGTAGGAAGGGCAACAGG - Intronic
969630255 4:8331779-8331801 GCCTGGGTCAGATGGGCAGAGGG - Intergenic
969757062 4:9156936-9156958 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
970120185 4:12745180-12745202 CTCTGGTTGGGAAGGGAAGAAGG - Intergenic
970561029 4:17282450-17282472 CTCTGGGGAATAAATGCAGAGGG - Intergenic
972805689 4:42527919-42527941 CTCTGGGGAAGGATGGGAGAAGG - Intronic
974436220 4:61860623-61860645 CTCTGGGGAAGGACCGCAGATGG - Intronic
974841612 4:67305930-67305952 TTCTATGTAAGAAGGGGAGAAGG - Intergenic
975173613 4:71261416-71261438 ATCTGGTTAAGAAGGGCTGTTGG + Intronic
975590449 4:75994516-75994538 CTCTGAGTGAGAAGGGAAGTTGG - Intergenic
977456178 4:97262878-97262900 CTCTGTGTATGAAGGGCCCATGG - Intronic
977945915 4:102913919-102913941 CTCTGTCTAAGCAGGGCACAAGG - Intronic
978415683 4:108473603-108473625 CTCTGGGTAGGAAGGCAAGGGGG + Intergenic
979069944 4:116189530-116189552 CTCTGGGAAATAAGGCCAGTAGG + Intergenic
982689551 4:158532480-158532502 CTGTTGGTCAGAAGGGGAGAAGG - Intronic
982988884 4:162245164-162245186 GTAAGGGTCAGAAGGGCAGAAGG + Intergenic
984107727 4:175571090-175571112 CTCTGGGGATGAAAGGCACAAGG + Intergenic
984888978 4:184474641-184474663 CACTGGGGAGGAAGGGCGGAGGG - Intergenic
985543975 5:500112-500134 CTGTGGGTTGAAAGGGCAGAGGG + Intronic
987182769 5:15385052-15385074 CTCTGGGGGAGAAGGGGAGAGGG - Intergenic
988450413 5:31336909-31336931 CTTAGGGCAAGAAGGGAAGAGGG + Intergenic
988594329 5:32577621-32577643 CTCTGGCTAAGCAGGGCTGTTGG + Intronic
988731950 5:33981187-33981209 CTCTGTGTAAGGAAGGCAGAGGG - Intronic
989679211 5:44009282-44009304 CTCAGGGGAAGTAGGGGAGAGGG - Intergenic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
991964412 5:72076986-72077008 CCCTGGGCCAGAAGGGGAGAAGG - Intergenic
992009425 5:72511975-72511997 ATCTGGGCAAGAAGGTCAGGAGG + Intergenic
992321396 5:75616507-75616529 ATCTGGCTTAGAAGGTCAGAAGG - Intronic
992522194 5:77565684-77565706 CACTAGGTAAGAAGGTCAGATGG - Intronic
995865267 5:116683596-116683618 CTCTGGGAAAGCAAGGCAGGGGG + Intergenic
997964709 5:138347896-138347918 CTATGACTTAGAAGGGCAGAGGG - Exonic
998383580 5:141742949-141742971 CCCTGAGGAATAAGGGCAGAGGG + Intergenic
998506823 5:142679040-142679062 CGATGGGCTAGAAGGGCAGATGG - Intronic
999247964 5:150165490-150165512 CTCTGGGTCAGGAAGTCAGATGG - Intergenic
999728361 5:154455724-154455746 CCCTGGGGAGGAAGGGCAAAGGG + Intronic
1000724248 5:164749317-164749339 CTCTGAGTAAGGAGGAGAGAAGG - Intergenic
1001317052 5:170651072-170651094 CTCTGCCTCTGAAGGGCAGAGGG + Intronic
1002426622 5:179180613-179180635 TTCTGGGTAATGAGGGCAGGGGG - Intronic
1002599992 5:180348579-180348601 CTCAGGGTAAGAAGGGGACTTGG + Intronic
1003489658 6:6610383-6610405 CTGTGGGTCATAAAGGCAGAGGG - Intronic
1004505545 6:16244006-16244028 ATTTGGGTGAGAAGGGAAGAGGG + Intronic
1007111966 6:39317998-39318020 GTCTGGGGAAGAGGAGCAGAGGG - Intronic
1008140449 6:47825762-47825784 TTATGGGGAAGAAGGGAAGAAGG + Intronic
1009369872 6:62885731-62885753 CTCTGGGTAGGAAATGGAGAAGG + Intergenic
1009529278 6:64789345-64789367 CTCTGGTTAAGAAAGGCAGAAGG - Intronic
1011227586 6:85124832-85124854 GTGTGGGTAAGAAGGGCAATGGG + Intergenic
1012052634 6:94362622-94362644 CTCTGGGGATGCAGGGCACAGGG + Intergenic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1012936824 6:105376858-105376880 ATCTCTGTAAGAATGGCAGAGGG + Intronic
1015337732 6:132060479-132060501 CACTGGGTTAGAATAGCAGAAGG + Intergenic
1015402523 6:132802224-132802246 CTTTGGGGAACCAGGGCAGATGG - Intergenic
1015584671 6:134763350-134763372 CAATGGGTAGAAAGGGCAGATGG + Intergenic
1018038641 6:159902987-159903009 CTGTGGAAAAGAAGGGCTGAGGG - Intergenic
1019485216 7:1286129-1286151 CTCAGGGTATGACGGGCAGAGGG + Intergenic
1019645873 7:2128723-2128745 CCCAGGGTGAGAAGGGCAGAGGG - Intronic
1020429626 7:8105682-8105704 CTCTGAGCAACCAGGGCAGAGGG - Intergenic
1020745864 7:12076986-12077008 CTCTGGGAAAGAAGAGCATCTGG - Intergenic
1021549288 7:21852626-21852648 CACAAGGTAGGAAGGGCAGAGGG + Exonic
1023330734 7:39113842-39113864 CTCTTGGTCACAAGGGCTGATGG + Intronic
1023392364 7:39722362-39722384 GTCTGGCTGAGAAGGGAAGATGG + Intergenic
1024300650 7:47885088-47885110 CTCTGGGAAAGGAGGGCTGAGGG - Intronic
1024369108 7:48559578-48559600 TTCTGCTTGAGAAGGGCAGAGGG - Intronic
1024858975 7:53815548-53815570 CTATGGGAAAGAAGGGAAGATGG - Intergenic
1026394201 7:69935169-69935191 CTCTGGGAAAAAAGGACGGAGGG + Intronic
1026552765 7:71381953-71381975 TTGTGGGAAAGAAAGGCAGAGGG + Intronic
1026941629 7:74290528-74290550 CCCTGGGAAGGACGGGCAGAGGG + Intronic
1028025654 7:85834946-85834968 CTCTGGATAGGAAGGACACAAGG + Intergenic
1029465619 7:100722873-100722895 CTTTCTGTAAGAAGGGGAGAAGG + Intronic
1029539910 7:101176585-101176607 CTATGGGGAAGAGGGGCAGAAGG - Intronic
1032408953 7:131678937-131678959 CAATGGGGAAGAAGGGGAGAGGG + Intergenic
1033617372 7:143029479-143029501 CCCTTGGGAAGAAGGGAAGAGGG - Intergenic
1034003438 7:147442553-147442575 TTCTGCTTAAGAAAGGCAGAGGG - Intronic
1034113301 7:148559386-148559408 CTATGGGGAAGAAGGGAATAGGG - Intergenic
1034535002 7:151720940-151720962 AGCGGGGTAATAAGGGCAGAAGG + Intronic
1034875831 7:154724221-154724243 CTCTGGGGAGGAGGGGGAGATGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035642091 8:1191571-1191593 TTCTATGTAAGAAGTGCAGAGGG - Intergenic
1036380292 8:8232251-8232273 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
1039346200 8:36708321-36708343 ATGTGGGAAAGAGGGGCAGAAGG + Intergenic
1039615970 8:38955208-38955230 CTCAGGGTGGGAAGGGCAGGAGG - Intronic
1041741478 8:61162077-61162099 CTCTGGGAAAGACGGCAAGAAGG - Intronic
1044928232 8:97227257-97227279 CTCAGAGGAAGAAGGGCAAAGGG + Intergenic
1046509593 8:115185183-115185205 CACTGGGACAGAAGAGCAGATGG + Intergenic
1046834373 8:118783043-118783065 CTCTGGGTAAGTAAGCCACATGG - Intergenic
1047893007 8:129333797-129333819 CTCTCAGTAAGAATGGAAGAAGG + Intergenic
1047933389 8:129751948-129751970 TTCAGGGAAAGAAGGGCAGAAGG - Intronic
1049347947 8:142148663-142148685 CTCTGGGGCCGAAGGCCAGATGG + Intergenic
1049800052 8:144513481-144513503 CTTTGGGGAAGACAGGCAGATGG + Intronic
1050365039 9:4866208-4866230 CTAAGGGTCAGAAGGACAGAGGG - Intronic
1051318577 9:15872738-15872760 CTGTGGTTCAGAAGGGTAGAAGG + Intronic
1052181579 9:25534894-25534916 ATCTGGGAAAGAAGGACAGTAGG + Intergenic
1055584939 9:77748941-77748963 CTCAGGGTAAGAAAGGGAAAGGG + Intronic
1057879382 9:98781714-98781736 CTCTAGCTAAGAGGGGCAGCAGG + Intronic
1057927849 9:99168962-99168984 CTCTGTGTAAGAAGGGAGGGAGG - Intergenic
1058021994 9:100099178-100099200 CTGTGGGATAGAAGGGCGGAGGG + Intergenic
1060275287 9:122177881-122177903 CTCTGTGGGAGAAGGGGAGAGGG - Intronic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1062005776 9:134237776-134237798 CCCTGGGACAGAATGGCAGAGGG - Intergenic
1062018473 9:134304342-134304364 CTCAGGGTACGAAGTGCAGGCGG - Intergenic
1062321416 9:135992339-135992361 CTCTGGGTAGGGTGGCCAGAGGG - Intergenic
1062703540 9:137921112-137921134 ACCTGGGTAATAAGTGCAGATGG + Intronic
1186897638 X:14020359-14020381 CTTTGGGGAAGAAGCGCAGAAGG + Exonic
1186914922 X:14208556-14208578 CCCAGGGTTACAAGGGCAGAGGG + Intergenic
1188564177 X:31506602-31506624 ATCTTTGTAAAAAGGGCAGAGGG - Intronic
1188807001 X:34603546-34603568 CACTGGGTAAAAAGGGGACAAGG - Intergenic
1189665571 X:43351153-43351175 CCCTGGGTCACGAGGGCAGAGGG + Intergenic
1190364099 X:49675586-49675608 CTCTGGGAACAAATGGCAGAGGG - Intergenic
1192448054 X:71224943-71224965 ATGTGGGTAAGAGGAGCAGAGGG + Exonic
1194067338 X:89277477-89277499 CTCTGTGTAAAAGGGGAAGATGG - Intergenic
1197861849 X:130979551-130979573 CTCTGGGTGAGGTGGGCAAAAGG - Intergenic
1198734990 X:139775696-139775718 CCCTAGGTAAGGAGGGCAGAGGG - Intronic
1200691464 Y:6308708-6308730 ATCTGGGAAGGAAGGGCAGTGGG - Intergenic
1200721496 Y:6611691-6611713 CTCTGTGTAAAAGGGGAAGATGG - Intergenic
1201043808 Y:9866008-9866030 ATCTGGGAAGGAAGGGCAGTGGG + Intergenic