ID: 1103254776

View in Genome Browser
Species Human (GRCh38)
Location 12:119531679-119531701
Sequence CAGTGAGTATGGAAGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 595
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 546}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103254771_1103254776 23 Left 1103254771 12:119531633-119531655 CCAAAGCAGCACACGACTTGACT 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1103254776 12:119531679-119531701 CAGTGAGTATGGAAGGAAGCAGG 0: 1
1: 0
2: 3
3: 45
4: 546
1103254770_1103254776 24 Left 1103254770 12:119531632-119531654 CCCAAAGCAGCACACGACTTGAC 0: 1
1: 0
2: 0
3: 12
4: 99
Right 1103254776 12:119531679-119531701 CAGTGAGTATGGAAGGAAGCAGG 0: 1
1: 0
2: 3
3: 45
4: 546

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103254776 Original CRISPR CAGTGAGTATGGAAGGAAGC AGG Intronic
900303520 1:1990142-1990164 CAGTAAGTATGGAAAGATACAGG + Intronic
900816641 1:4852271-4852293 AAGTCAGGATGGAAGGAAGGAGG + Intergenic
902579353 1:17398598-17398620 CCTTCAGTATGGAAGGAAACTGG + Intronic
903550755 1:24156208-24156230 CAGTGAGGGTAGAAGGAAGGAGG + Exonic
904206185 1:28856760-28856782 CAGAGAGCATGGAGGGATGCTGG + Intronic
904595382 1:31641357-31641379 CTGTGAGAATGGATTGAAGCAGG - Intronic
904623415 1:31789040-31789062 CAGTTGGTATGGAGGGAAACGGG - Intergenic
905573042 1:39021223-39021245 CAGAGAGAATGGAAGGAAGGAGG - Intergenic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907239961 1:53075875-53075897 CAGGGCGTTTGGCAGGAAGCGGG - Exonic
907273118 1:53302255-53302277 CAGTGCGTTTGGAAGGAAATGGG + Intronic
907744202 1:57196427-57196449 CAGTGAGTGTGGGAGGCAGGTGG + Intronic
908691178 1:66781708-66781730 CAGGGAGAATGGAACCAAGCTGG + Intergenic
908726320 1:67181231-67181253 CAGGGAGAATGGAACCAAGCTGG - Intronic
910616170 1:89200726-89200748 CACTGATTTTGGAAGGAAACTGG + Intergenic
910642159 1:89474781-89474803 CAGTGAGAATGGAACCAAGTTGG + Intergenic
910827668 1:91427042-91427064 CAGGGAGAATGGAATGAAGTTGG - Intergenic
910957507 1:92722892-92722914 CAGTGGGTAAGGTAGAAAGCTGG - Intronic
911389975 1:97229442-97229464 CAGTTAGAATGGAAGAAAGATGG + Intronic
911689948 1:100821483-100821505 CAGGGAGAATGGAAGCAAGTTGG + Intergenic
912225915 1:107733784-107733806 CAGGGAGAATGGAATCAAGCTGG + Intronic
912330473 1:108815817-108815839 CAGTGAGGATGGAGGGAAACTGG - Intergenic
912703908 1:111897954-111897976 CCGTGTTTATGGAAGGAAGGTGG - Intronic
912998739 1:114558193-114558215 CAGTGAGTTTGGAAGGAAACTGG + Intergenic
913290868 1:117270344-117270366 CAGTGAGCATGTTAGGATGCAGG + Intergenic
913990075 1:143603210-143603232 CAGGGAGAATGGAACCAAGCTGG + Intergenic
915096499 1:153466383-153466405 CACTCAGTATGGCAGGAAGGGGG - Intergenic
915564820 1:156707451-156707473 CAGAGATGGTGGAAGGAAGCGGG + Intergenic
915711495 1:157903367-157903389 CAGGGAGAATGGAATCAAGCTGG + Intergenic
915760032 1:158301883-158301905 CAGGGAGAATGGAACCAAGCTGG - Intergenic
916612652 1:166408524-166408546 CAGTGAGAATGGAAACAAGTTGG - Intergenic
916811036 1:168306056-168306078 CACTGAGGAAGGAAGGAGGCTGG - Intronic
916985787 1:170190410-170190432 CAGAGAGAATGGAAGCAAGTGGG - Intergenic
917896498 1:179493911-179493933 CAGTGAGTATGTAAAGCAACTGG - Intronic
918005399 1:180537106-180537128 CAGTGATTATGACAGGAAACTGG + Intergenic
918133071 1:181646025-181646047 CAGTGAGTGGGGAAGGAAAGAGG - Intronic
918156375 1:181850647-181850669 CAGGGAGAATGGAAAAAAGCTGG + Intergenic
918761869 1:188420602-188420624 GAGTGAGGAAGGAAGGAAGAAGG - Intergenic
919921886 1:202171090-202171112 CAGTGCATAGGGAATGAAGCCGG + Intergenic
920775373 1:208931624-208931646 CACTGAATCTGGAAGGAATCAGG + Intergenic
920974092 1:210769461-210769483 TAGTGAGTTTGGGAGGGAGCTGG - Intronic
921281166 1:213569439-213569461 CTAAGAGTATAGAAGGAAGCTGG - Intergenic
921293373 1:213679274-213679296 CTGTGAGTATGGAAGGACATAGG - Intergenic
922066371 1:222147316-222147338 CAGGGAGTATGGAACCAAGTTGG + Intergenic
922245659 1:223794990-223795012 CAGTAAGCACGGAAGGAAGTAGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923570328 1:235107704-235107726 CAGTGAGGCTGGAAAGAAGTGGG + Intergenic
923635388 1:235691360-235691382 CAGTTAGTATATAACGAAGCTGG + Intronic
923942448 1:238843339-238843361 CAGAGAGAATGGAACCAAGCTGG - Intergenic
924136104 1:240968471-240968493 TAGTGAGCACGGCAGGAAGCAGG + Intronic
924220788 1:241873289-241873311 CATTGAGTCTAGAGGGAAGCAGG + Intronic
924254742 1:242170935-242170957 CAGGGAGAATGGAACCAAGCTGG + Intronic
924311359 1:242746725-242746747 CAGTGAGTTGGGAAGAAAACAGG - Intergenic
924631490 1:245744832-245744854 CAGGGAGAATGGAACCAAGCTGG - Intergenic
924639900 1:245824039-245824061 TCGTGAGTAGGGGAGGAAGCTGG - Intronic
924696279 1:246403478-246403500 CAGGGAGTAAAGAAGGAAACTGG - Intronic
1062885223 10:1011064-1011086 CAGTCAGGATGGAGGGATGCAGG - Intronic
1062885246 10:1011150-1011172 CAGTCAGGATGGAGGGATGCAGG - Intronic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1065107964 10:22409707-22409729 CAGTGACTAAGGAAGAGAGCAGG + Intronic
1065367185 10:24948208-24948230 AAGTGAGTTTGGTAGGAATCAGG - Intronic
1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG + Intergenic
1067094494 10:43290215-43290237 CTGTGAGTTTCGATGGAAGCAGG + Intergenic
1067283773 10:44892639-44892661 CAGAGACTGTGGAAGGTAGCAGG - Intergenic
1067785448 10:49242406-49242428 CAGTGAGTTGGTAGGGAAGCCGG - Intergenic
1068067288 10:52147855-52147877 CAGCAAGTCTGGATGGAAGCTGG + Intronic
1068214805 10:53969401-53969423 CAGTGAGAATGGAACCAAGTTGG + Intronic
1068493994 10:57761890-57761912 CAGTGTGTTTTGAAAGAAGCTGG + Intergenic
1068532553 10:58206293-58206315 CAGGGAGTTTGGAAGGAAATTGG + Intronic
1068963194 10:62886115-62886137 CAGTGAGTCAGGAGGGAAGCTGG + Intronic
1070726332 10:78793724-78793746 CAGTGAGTGTGGCAGGAAGAAGG - Intergenic
1071421382 10:85503648-85503670 CAGAGAGAATGGAACCAAGCTGG - Intergenic
1071838714 10:89446150-89446172 CAGGGAGAATGGAACCAAGCTGG + Intronic
1071986889 10:91060991-91061013 CAGTGAGCCTGGCAGGAAGGTGG - Intergenic
1072892891 10:99340858-99340880 CAGGAAGGAAGGAAGGAAGCGGG - Intronic
1073661317 10:105479606-105479628 CAGGGAGAATGGAAGCAAGTTGG - Intergenic
1075415093 10:122256815-122256837 CAGGGAGGATTGCAGGAAGCTGG + Intergenic
1075706463 10:124504892-124504914 CAGTGCGTCTGGGAGGGAGCGGG + Intronic
1076230143 10:128813453-128813475 GAGGGAGGGTGGAAGGAAGCAGG + Intergenic
1076485901 10:130816786-130816808 CAGTGGGTTTGGAAGGAGTCAGG - Intergenic
1076946708 10:133656573-133656595 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
1077574978 11:3376106-3376128 GAGTTGGGATGGAAGGAAGCTGG - Intronic
1077591720 11:3497548-3497570 CAGTGAGAATGGAACCAAGTTGG - Intergenic
1078778970 11:14419315-14419337 CAGTGAGTGTGTCAGGAAGCCGG + Intergenic
1078871346 11:15348086-15348108 TAGTGAGTCTGGTAGGAAACTGG - Intergenic
1079984120 11:27182311-27182333 CAGTGATTAAGGGTGGAAGCAGG + Intergenic
1080491016 11:32764156-32764178 CAGGGAGAATGGAACCAAGCTGG + Intronic
1081241282 11:40709786-40709808 CAGGGAGAATGGAACGAAGCTGG - Intronic
1081907863 11:46680619-46680641 CAGTAAGTATGAAAGGTGGCTGG - Exonic
1082112659 11:48293964-48293986 CAGGGAGAATGGAAGCAAGTTGG + Intergenic
1082871983 11:57952128-57952150 CAGGGAGAATGGAAACAAGCTGG - Intergenic
1083003542 11:59320066-59320088 CAGGGAGAATGGAACCAAGCTGG - Intergenic
1084542678 11:69797322-69797344 CAGTGAGCAGAGAAGGACGCTGG + Intergenic
1084825267 11:71725228-71725250 CAGTGAGAATGGAACCAAGTTGG + Intergenic
1085716985 11:78881246-78881268 GAGTGAGTGTGGAAGGCAGCGGG - Intronic
1085823603 11:79819207-79819229 CAGAAAGCATGGAAGGAAGTGGG - Intergenic
1085852386 11:80137209-80137231 CATTGAGAATGAAAGAAAGCTGG - Intergenic
1086567385 11:88242006-88242028 CAGGGAGAATGGAAGCAAGTTGG + Intergenic
1087513650 11:99129506-99129528 CAGGGAGAATGGAAGCAAGTTGG + Intronic
1089588516 11:119525000-119525022 CAGTGTGGAGGGAAGGCAGCTGG - Intergenic
1090154443 11:124422969-124422991 CAGGGAGTCTGGAAGGGATCTGG - Intergenic
1090366620 11:126211829-126211851 CGGTGAGTGTGTAGGGAAGCCGG + Exonic
1090803554 11:130189003-130189025 CAGTGTGTGGGGCAGGAAGCGGG + Intronic
1090932855 11:131314094-131314116 CAGGGAGAATGGAACCAAGCTGG + Intergenic
1091161847 11:133429951-133429973 CAGTGAGTCTGGATGGAAGCGGG + Intronic
1091303527 11:134523105-134523127 GAGTGGGGATGGAAGGAAGGTGG + Intergenic
1092037766 12:5353799-5353821 CAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1092159356 12:6307575-6307597 CAGTAAATGTGGAAGGAAGGGGG + Intergenic
1093988793 12:25567691-25567713 CAGTGAGAGTGGAAGCAAGATGG - Intronic
1094698099 12:32841657-32841679 CAGTTAGTGGGGAAGGAGGCAGG - Intronic
1094827194 12:34278842-34278864 CAGGGAGAATGGAACCAAGCTGG + Intergenic
1095490056 12:42724413-42724435 CAGTGAGAATGGAACCAAGTTGG - Intergenic
1095831328 12:46590274-46590296 CAGGGAGTATGGAACCAAGTTGG - Intergenic
1095835119 12:46629475-46629497 CAGACAGTTTGGGAGGAAGCAGG - Intergenic
1096297678 12:50397641-50397663 CAGTGGGGAAGGAAGGAACCAGG - Intronic
1096368016 12:51044989-51045011 CAGAGAAGATAGAAGGAAGCTGG + Intergenic
1096589374 12:52647333-52647355 CAGTGAGTATTGAGGGCAGCTGG - Intronic
1096752280 12:53768383-53768405 CAGGGAGTATAGCAGGAGGCTGG + Intergenic
1097097773 12:56563356-56563378 CAGTGGGGATGGAAGAAAGTGGG + Intronic
1097753074 12:63379146-63379168 CAGGGAGAATGGAACCAAGCTGG + Intergenic
1097966531 12:65587364-65587386 CGGTCATTATGGAGGGAAGCAGG + Intergenic
1097994496 12:65872741-65872763 CAGTGATAATGGAGGTAAGCTGG - Intronic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1099684151 12:85864792-85864814 CAGGGAGCATGGAAACAAGCAGG - Intergenic
1100417287 12:94391020-94391042 CAGGGAGAATGGAACCAAGCAGG + Intronic
1100725112 12:97400348-97400370 CAGTGCGAATGGAAGGACCCAGG - Intergenic
1101206440 12:102492992-102493014 CAGGGAGAATGGAAGCAAGTTGG - Intergenic
1101331550 12:103761573-103761595 GAGTGGGGATGGCAGGAAGCAGG - Intronic
1102753149 12:115313808-115313830 CAGTGAGTGGGGATGGGAGCTGG - Intergenic
1102881018 12:116485048-116485070 CAGAGAGTAAGGGATGAAGCTGG - Intergenic
1103254776 12:119531679-119531701 CAGTGAGTATGGAAGGAAGCAGG + Intronic
1103767720 12:123293540-123293562 CAGTGTGAATGGATGGGAGCTGG - Exonic
1104086422 12:125478654-125478676 CAGGGAGAATGGAACCAAGCTGG + Intronic
1104176502 12:126338031-126338053 CAGTAACAAAGGAAGGAAGCTGG + Intergenic
1104256234 12:127141897-127141919 CAGGGAGAATGGAAACAAGCTGG - Intergenic
1104300614 12:127561832-127561854 GAGTGAAGATGGAAGGAAGTGGG + Intergenic
1105435897 13:20378161-20378183 CAGTGAGTGGGGAAGGGAGGAGG - Intergenic
1106326181 13:28692668-28692690 CAGGGAGAATGGAACCAAGCTGG - Intergenic
1106522817 13:30512833-30512855 CACTCAGTATTGAAGGATGCAGG - Intronic
1107281052 13:38735762-38735784 CAGTGAGCATGGGAGGAGTCAGG + Intronic
1107780132 13:43891479-43891501 CAGTCAGTTTGGAAGGAGGCAGG - Exonic
1108186143 13:47890353-47890375 CAGTGTGCATGACAGGAAGCTGG - Intergenic
1108308429 13:49162205-49162227 CAGGGAGAATGGAACCAAGCTGG - Intronic
1108592654 13:51924644-51924666 CAGGCAGGACGGAAGGAAGCAGG - Intergenic
1109659277 13:65436935-65436957 CAGGGAGAATGGAACCAAGCTGG + Intergenic
1110370745 13:74737579-74737601 CATTGAGAAGGGAAGGGAGCAGG + Intergenic
1110606807 13:77442433-77442455 CAGGGAGAATGGAACCAAGCTGG - Intergenic
1112323647 13:98429186-98429208 CAGTGAGTGCGGGAGGATGCAGG + Intronic
1113894546 13:113755294-113755316 GAGTGAGTAGAGAAGGAAGGTGG + Intergenic
1113933550 13:113981397-113981419 CAGAGAGGCTGGGAGGAAGCAGG + Intronic
1114887287 14:26869486-26869508 CAGTCACAATGGAAGGAAACTGG + Intergenic
1115008031 14:28510364-28510386 CAGGGAGAATGGAACCAAGCTGG - Intergenic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116560763 14:46376191-46376213 CAGGGAGAATGGAAACAAGCTGG - Intergenic
1118046272 14:61974777-61974799 CACTGAGTAAGTAAGGAAACAGG + Intergenic
1118313275 14:64708271-64708293 CATTGAGTCTGGCTGGAAGCAGG - Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1120271628 14:82320683-82320705 CAGGGAGGATGGAACCAAGCTGG - Intergenic
1121244494 14:92452122-92452144 TAGAGAGTGTGGAAGGAAGTGGG + Intronic
1122233932 14:100321638-100321660 CATAGAGTCTGGAAGGAAGGAGG - Intergenic
1122870491 14:104635983-104636005 CAGTTGGAATGGAAGGAGGCGGG - Intergenic
1202920792 14_KI270723v1_random:29127-29149 CAGAGAGTAGGGAAGGAAGTCGG + Intergenic
1202924124 14_KI270724v1_random:8454-8476 CAGAGAGTAGGGAAGGAAGTCGG - Intergenic
1125532147 15:40420625-40420647 CAGTGAGTTTTAAAGGAAGCAGG + Intronic
1126378294 15:48018898-48018920 CAGGCAGTAAGGAAGGAAGGTGG - Intergenic
1127290905 15:57570310-57570332 CAGAGAATATGGAAGGGAGAAGG + Intergenic
1127470752 15:59287812-59287834 CAGGGAGCATGGCAGGAACCAGG - Intronic
1127687534 15:61363704-61363726 CAGGGAGAATGGAAACAAGCTGG - Intergenic
1127848389 15:62891606-62891628 CAGTGAGTATGGCAGGTATCCGG + Intergenic
1128339694 15:66812584-66812606 CAGGGAGAATGGAATCAAGCTGG - Intergenic
1128681274 15:69653652-69653674 CAGTGAATAGGAAAGGAGGCTGG + Intergenic
1128856853 15:71025091-71025113 CAGGGAGAATGGAACCAAGCTGG + Intronic
1128998399 15:72313603-72313625 ACGTGAGCATGGAGGGAAGCTGG - Intronic
1129574321 15:76724524-76724546 CAGGGAGAATGGAAGCAAGTTGG - Intronic
1129621860 15:77155082-77155104 CAGGGAGAATGGAACCAAGCTGG - Intronic
1130063735 15:80588087-80588109 CAGTGAGAATGGAGGAAAGCAGG + Intronic
1130383849 15:83394312-83394334 CAGGAAGGAAGGAAGGAAGCGGG + Intergenic
1130530896 15:84747726-84747748 CAGTGAGTCTGGCAGAAGGCTGG - Intergenic
1130729101 15:86472105-86472127 TAGAGAGTTTGGAAGGAGGCTGG + Intronic
1131032722 15:89199943-89199965 CAGAGGGGAAGGAAGGAAGCAGG - Exonic
1131895114 15:97019710-97019732 CCCTTAGTATGGAAGGAAGAAGG + Intergenic
1132136388 15:99344308-99344330 CAGTTAGTAAGTGAGGAAGCAGG + Intronic
1133629209 16:7603184-7603206 TAGAGTCTATGGAAGGAAGCAGG + Intronic
1133663059 16:7937530-7937552 CAGTAAGTAAGGAAGGAAGTGGG - Intergenic
1133687807 16:8182827-8182849 CAGTGAGTCTGAAGTGAAGCGGG + Intergenic
1133741572 16:8655692-8655714 CACTGAATCTGGAAGGAAGTGGG + Intergenic
1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG + Intronic
1136627675 16:31472072-31472094 CCGTGACCATGTAAGGAAGCCGG - Exonic
1136647451 16:31634466-31634488 CAGGGAGAATGGAAGCAAGTTGG - Intergenic
1137503553 16:49030227-49030249 CGGGGAGTATGGAACCAAGCTGG + Intergenic
1137779734 16:51087891-51087913 AAGTGAGTGTAGAAGGCAGCAGG - Intergenic
1138101992 16:54259595-54259617 AAGAGAGAAAGGAAGGAAGCAGG + Intronic
1138614766 16:58156688-58156710 AAGTGACTATGGAGGAAAGCAGG - Intergenic
1139611188 16:68060103-68060125 CATTGAGTATGATAGGAAGAAGG + Intronic
1139654084 16:68376954-68376976 GAGCGGGTAGGGAAGGAAGCAGG - Intronic
1139732476 16:68958507-68958529 GAGAGAGGAAGGAAGGAAGCAGG + Intronic
1140126609 16:72123525-72123547 AAGTGAGTATGGGAGGAAAAAGG - Exonic
1141421640 16:83921462-83921484 CAGGGTATATGGAAGGAAGATGG + Exonic
1141701183 16:85642844-85642866 CAGCGAGCATGGAAGGAAAGGGG - Intronic
1141995833 16:87635897-87635919 GAGAGGGTCTGGAAGGAAGCAGG + Intronic
1142110333 16:88327693-88327715 CAGTGAGTGTGCACGGAAGGTGG - Intergenic
1142740200 17:1927410-1927432 GAGTGAGTGAGGAAGGAAGGAGG + Intergenic
1142880423 17:2879060-2879082 CAGTGGGTAGGGCAGGAAGGAGG - Intronic
1142911739 17:3099072-3099094 CAGGGAGAATGGAAACAAGCTGG + Intergenic
1143473859 17:7192147-7192169 CAGAGAGTCAGGCAGGAAGCGGG + Intronic
1143488084 17:7266231-7266253 CAGTGAGTTTGGAGAGAAGCTGG - Intergenic
1144278794 17:13703346-13703368 GAGTGAGGAAGGAAGGTAGCGGG + Intergenic
1144379836 17:14683767-14683789 CAGGGAGTGAGGAAGGAAGAAGG - Intergenic
1145738472 17:27250740-27250762 CAGGGAGAATGGAACCAAGCTGG + Intergenic
1146561759 17:33876210-33876232 CAGTGAGAATGAAATGAAACAGG + Intronic
1146638163 17:34521164-34521186 CAGTGAGTCTAGAAGGTAGGTGG - Intergenic
1147133655 17:38423016-38423038 CAGTGACTAGGGGAGGAAGAAGG - Intergenic
1148473005 17:47907162-47907184 GAGTGAGTAGGGAAGGAGGGAGG + Intronic
1148608920 17:48950907-48950929 CAAAGAGTAAGGGAGGAAGCAGG - Intergenic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1149055253 17:52355821-52355843 CAGGGAGAATGGAACCAAGCTGG - Intergenic
1149372032 17:56003925-56003947 CGGGGAGTATGGAACCAAGCTGG + Intergenic
1149517613 17:57292409-57292431 GAGTGAGTATGAAAGGAGGAGGG + Intronic
1150208017 17:63423797-63423819 CAGGGAGTGTGGAAAGAGGCTGG - Exonic
1150836223 17:68566351-68566373 CACTGATTATGGAAAGAAGTTGG + Intronic
1151084373 17:71363964-71363986 CAGTGAGTAGGGAAGAGGGCGGG - Intergenic
1151521276 17:74632117-74632139 CCGGGAGGATGGAAGGAGGCTGG - Intergenic
1151664161 17:75535907-75535929 CAGTGAGGAGGGAAGGAAACAGG + Intronic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1154305977 18:13231197-13231219 CAGGTGGTATGGGAGGAAGCGGG + Intronic
1156421761 18:36961359-36961381 CAGGGAGAATGGAACCAAGCTGG + Intronic
1156443638 18:37217766-37217788 CAGGGAGAATGGAACCAAGCTGG - Intronic
1156580599 18:38370452-38370474 CAGTGAATCTGGAAGGCAGGAGG + Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157632901 18:49117716-49117738 CAGTGGGTGTGGCAGGTAGCAGG - Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158577984 18:58656316-58656338 CAGTGAGGAAGGAAGGAGGTAGG - Intergenic
1158653097 18:59305216-59305238 CAGGGAGCAGGGAACGAAGCAGG + Intronic
1158729009 18:60002598-60002620 CAGGGAGAATGGAAACAAGCTGG - Intergenic
1159155768 18:64579678-64579700 CAGGGAGAATGGAAACAAGCTGG + Intergenic
1159231519 18:65613319-65613341 CAGGGAGGAGGGAAGGAAGAAGG + Intergenic
1160133019 18:76246488-76246510 AGGAGAGAATGGAAGGAAGCAGG - Intergenic
1160693663 19:472275-472297 CAGTTAGTGCGGCAGGAAGCAGG - Intronic
1162424012 19:10583180-10583202 CAGTGAGGAAGCAGGGAAGCTGG + Intronic
1163889692 19:19999910-19999932 CACTGTGTATGGTAGGAGGCTGG + Intronic
1165133344 19:33647270-33647292 CAGTGAGACAGGAAGAAAGCAGG + Intronic
1166651939 19:44581427-44581449 CGGGGAGTAAGGGAGGAAGCGGG - Intergenic
1166913922 19:46181143-46181165 CAGTGAGGCTGGAAGCAAGATGG - Intergenic
1167902647 19:52633515-52633537 CAGTGAGGCTGGAAGGAGGGTGG + Intronic
1167910351 19:52697031-52697053 CAGTGAGTTTGGAAAGAGGGTGG + Intergenic
1167918144 19:52759227-52759249 CAGTGAGGTTGGAAGGAGGGTGG + Intergenic
1167925231 19:52816082-52816104 CAGTGAGGCTGGAAGGAGGGTGG + Intronic
1167929565 19:52853248-52853270 CAGTGAGGCTGGAAGGAGGGTGG + Intronic
1167992647 19:53373531-53373553 CAGTGAGGCTGGAAGGAGGGTGG - Intronic
1167995589 19:53399381-53399403 CAGTGAGTTTGGAAGAAGGGTGG - Intronic
1168001318 19:53448439-53448461 CAGTGAGGCTGGAAGGAGGGTGG - Intronic
1168005704 19:53485002-53485024 CAGTGAGGCTGGAAGGAGGGTGG - Intronic
1168108951 19:54181204-54181226 CAGGGAGCTTGGAAGGAAGGTGG + Intronic
1168588434 19:57613707-57613729 CAGTGGCTATGGAGGGATGCTGG - Intergenic
1202646272 1_KI270706v1_random:144870-144892 GAGTGAGTATGGCAGGAATAGGG - Intergenic
925856517 2:8134517-8134539 CAGAGAGCTTGCAAGGAAGCTGG - Intergenic
927896160 2:26783808-26783830 CAGTGAGTAAGGGAGGAATGGGG - Intronic
928326206 2:30321663-30321685 CATTGAGGAGGGAAAGAAGCGGG - Intronic
931991054 2:67790851-67790873 CTGTGAGTTAGGGAGGAAGCTGG - Intergenic
932617990 2:73248057-73248079 CACAGAGTATGGAAAGAAGGGGG - Intronic
933129649 2:78656365-78656387 CAGGGAGAATGGAAACAAGCTGG + Intergenic
934479112 2:94618684-94618706 CAGTGAGTAGGGATGGATCCAGG + Intergenic
934856195 2:97731904-97731926 CAGTGAGGAGGGAGGGCAGCTGG - Intronic
935506576 2:103912003-103912025 CAGGGAGAATGGAAACAAGCTGG + Intergenic
935708448 2:105876791-105876813 CAGAGAGAATGAAAGGAAACTGG + Intronic
935960692 2:108423094-108423116 CAGAAAGAATGGAAGGAGGCAGG - Intergenic
936460805 2:112712691-112712713 CAGTGAGTGTGAAAGGGAGAAGG - Intergenic
936923455 2:117712612-117712634 CAGTGAGTATTCAGGGAATCAGG - Intergenic
937040537 2:118817279-118817301 CACTGAGTTTTGAAGGATGCAGG - Intergenic
937074182 2:119089084-119089106 CAAGGAGTAAGGAAGGCAGCAGG + Intergenic
937306017 2:120871349-120871371 CAGTGAGGATGCACGGGAGCTGG + Intronic
938387633 2:130878606-130878628 CAATGAGTAGGGATGGAACCAGG + Intronic
940030393 2:149256237-149256259 CAGGGAGAATGGAAGCAAGTTGG - Intergenic
940554776 2:155209907-155209929 CAGAAAGGAAGGAAGGAAGCAGG + Intergenic
940599701 2:155843195-155843217 AAGTGAGAAAGGAAGGAAGATGG - Intergenic
940801461 2:158137328-158137350 AGGTGAGCATGGAAGGAATCTGG - Intergenic
941073113 2:160976994-160977016 CAGTTAGTATGTAACAAAGCTGG + Intergenic
941365009 2:164599685-164599707 CACTAAGTCTGGAAGGAAGGAGG + Intronic
941731310 2:168921373-168921395 GAGTGAGCTTGGGAGGAAGCTGG + Intergenic
942181937 2:173388496-173388518 CAGAGGGTCTGGAAGGAAGCAGG + Intergenic
943088751 2:183349221-183349243 CAGAGAGCCTGGAGGGAAGCGGG - Intergenic
943409955 2:187534112-187534134 CAGGGAGAATGGAAAGAAGTTGG + Intronic
943514198 2:188863793-188863815 CAGGGAGAATGGAAACAAGCTGG + Intergenic
943662923 2:190578327-190578349 GAGGGAGGATGGAAGGAAGCTGG - Intergenic
944393454 2:199244191-199244213 CAGGGAGAATGGAACCAAGCTGG - Intergenic
945666870 2:212754320-212754342 CAGAGAGAATGGAAGCAAGTTGG + Intergenic
947030189 2:225783446-225783468 GAGTGAGAAAGGAAGGAAGGGGG - Intergenic
947470027 2:230392868-230392890 CAGTGAATATTTAAGGAAGAGGG - Intronic
947499388 2:230660866-230660888 CAGAGAATCAGGAAGGAAGCTGG - Intergenic
948931072 2:241132720-241132742 CAGTGTGTGTGGAAGAGAGCAGG + Intronic
949049246 2:241888424-241888446 GAGGGAGGATGGGAGGAAGCAGG - Intergenic
949049258 2:241888462-241888484 GAGGGAGAATGGGAGGAAGCAGG - Intergenic
949049283 2:241888538-241888560 GAGGGAGAATGGGAGGAAGCAGG - Intergenic
949049295 2:241888575-241888597 GAGGGAGGATGGGAGGAAGCAGG - Intergenic
949049307 2:241888613-241888635 GAGGGAGAATGGGAGGAAGCAGG - Intergenic
949049332 2:241888689-241888711 GAGGGAGAATGGGAGGAAGCAGG - Intergenic
1168949368 20:1786158-1786180 AGGTGGGTAAGGAAGGAAGCAGG + Intergenic
1169007719 20:2222669-2222691 TAGGGAGTTTGGAAGGTAGCAGG - Intergenic
1169979074 20:11363409-11363431 AGGAGAGAATGGAAGGAAGCTGG - Intergenic
1169980760 20:11381083-11381105 CAGGGAGAATGGAAACAAGCTGG + Intergenic
1170052728 20:12164450-12164472 TTGTGACTATGGAAGGAGGCAGG + Intergenic
1171410558 20:24944325-24944347 CAGGGAGAATGGAACCAAGCTGG + Intergenic
1172128536 20:32639960-32639982 TCGTGAGAATGAAAGGAAGCAGG - Intergenic
1173300644 20:41799364-41799386 AGCTGAGTATGGAGGGAAGCTGG + Intergenic
1173448260 20:43139316-43139338 CAGGGAGTATGGAGGAGAGCTGG - Intronic
1174199050 20:48794356-48794378 CAGAGAGTCCTGAAGGAAGCTGG + Intronic
1174886449 20:54340303-54340325 AAGGGAGTATGGAAGAAAGAAGG - Intergenic
1175357029 20:58376600-58376622 CAGTCAGGATGGATGGAAGAAGG - Intergenic
1175447169 20:59031189-59031211 CAGTTAGTAAGAATGGAAGCAGG - Intronic
1175597991 20:60250701-60250723 CAGTGAGCAGGCAAGGAAGCAGG + Intergenic
1176928592 21:14780447-14780469 CAGGGAGAATGGAAACAAGCTGG + Intergenic
1177433127 21:21016069-21016091 CAATGAGTATTGAGGGAAGTTGG - Intronic
1177694735 21:24556366-24556388 CAGGGAGAATGGAACGAAGTTGG + Intergenic
1178310534 21:31526268-31526290 CAGGGAAGATGGAAGGCAGCGGG + Intronic
1179215323 21:39362342-39362364 CAGAGAGTTTGAGAGGAAGCTGG + Intergenic
1179712669 21:43272360-43272382 CAGTGAGCCTGGAGGGAGGCAGG + Intergenic
1179801853 21:43814953-43814975 GAGGGAGGAAGGAAGGAAGCAGG + Intergenic
1181096660 22:20509604-20509626 CATTGTGGAAGGAAGGAAGCCGG + Intronic
1181393449 22:22600635-22600657 CAGAGAGCATGGATGGATGCTGG - Intergenic
1181744510 22:24946516-24946538 GAGTGAGGAGGGAAGGAAACTGG - Intronic
1181822007 22:25483773-25483795 CAGTGAGAAAGGAAGTGAGCAGG + Intergenic
1183483569 22:38077689-38077711 CAGTGAGCAAGGAAGTCAGCGGG + Intergenic
1184473546 22:44709022-44709044 CAGTGATTTGGGACGGAAGCTGG + Intronic
1184482350 22:44755243-44755265 CAGTGTGTGTGGGAGGAAGGTGG - Intronic
1184912844 22:47547667-47547689 CAGTGAGTAGGTATGGAAGAAGG + Intergenic
949592861 3:5511747-5511769 CAGGGAGAATGGAAACAAGCTGG + Intergenic
949916876 3:8971965-8971987 CAGTGAGAAAGGAGGGAAGCTGG + Intergenic
949955213 3:9261743-9261765 CAGGGAGAATGGAACCAAGCTGG + Intronic
950034029 3:9871570-9871592 CAGTGAGGATGTAAGGAGACTGG - Intronic
950302750 3:11895712-11895734 CAGGGAGAATGGAACCAAGCTGG + Intergenic
951201585 3:19881263-19881285 CAAGGAGTGGGGAAGGAAGCAGG - Intronic
951346154 3:21548572-21548594 CCGTAAGTATGGAAGGGAACAGG - Intronic
951532473 3:23710695-23710717 CAGTGAGTAGGGCAGGAAGCAGG - Intergenic
951565193 3:24005878-24005900 CAGGGAGAAAGGAAGGATGCAGG - Intergenic
951708594 3:25567978-25568000 CAGAGAGAATGCAAAGAAGCCGG - Intronic
951957620 3:28274709-28274731 CAGGAAGTATGGAAACAAGCTGG - Intronic
952634183 3:35506669-35506691 CAGGGAGAATGGAACCAAGCTGG + Intergenic
953047388 3:39306073-39306095 CAGGGAGAATGGAACGAAGTTGG + Intergenic
953060214 3:39421728-39421750 CTGTTAGTATGGAAGAAAGGAGG - Intergenic
953305595 3:41825702-41825724 CAGGGAGAATGGAACCAAGCTGG + Intronic
953699598 3:45185556-45185578 GTGTGTGTGTGGAAGGAAGCTGG + Intergenic
954149809 3:48651753-48651775 CGCAGAGCATGGAAGGAAGCAGG + Intronic
954790028 3:53125477-53125499 CACTGAGGAGGGAAGGAAGGTGG + Intronic
955055951 3:55456310-55456332 CAGTGAGCAGAGAAGGCAGCTGG - Intergenic
955226225 3:57062492-57062514 CAGAGAAGAGGGAAGGAAGCAGG + Intronic
956005974 3:64778336-64778358 CAGAGAGAATGGAACCAAGCTGG + Intergenic
956993434 3:74795754-74795776 CAGTGAGAATGGAACCAAGTTGG + Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957080746 3:75633837-75633859 CAGAGAGTAGGGAAGGAAGTCGG - Intergenic
957220859 3:77380721-77380743 CTGTGATGATGGAAGGAAGGAGG - Intronic
957291510 3:78282852-78282874 CAGGGAGAATGGAAACAAGCTGG + Intergenic
958481789 3:94653060-94653082 CAGGGAGAATGGAAACAAGCTGG - Intergenic
958624560 3:96607309-96607331 CAGTGAGCATGGGCTGAAGCAGG - Intergenic
959626334 3:108456372-108456394 CAGGGTGTATGGCAGGAGGCAGG - Intronic
959736602 3:109666279-109666301 CAGGGAGAATGGAACCAAGCTGG + Intergenic
959737480 3:109676380-109676402 CAGTCAGTATGGAAGAAGACAGG + Intergenic
959910962 3:111763121-111763143 AAGTGAGTATGTTAGGAAACTGG + Intronic
959932934 3:112002615-112002637 CAGTGTGAATGGAAGGGACCCGG + Intronic
960463541 3:117967178-117967200 CAGTGAGGCTAGAACGAAGCTGG + Intergenic
960622518 3:119650686-119650708 GAGTGAGTGTGGATGGAAGAGGG - Intronic
960897788 3:122523555-122523577 GAGTGAGAAAGGAAGGAAGGAGG - Intergenic
960908802 3:122628129-122628151 AACTGAGTATGGAAGGATGTAGG - Intronic
961310746 3:125998096-125998118 CAGGGAGAATGGAACCAAGCTGG + Intergenic
961624148 3:128247959-128247981 CAGTAAGTGTGGAAGAAAGCTGG + Intronic
962239127 3:133735849-133735871 CAGGGAGAATGGAACCAAGCTGG + Intergenic
962347562 3:134629562-134629584 CAGAGAGGATTGAAGGCAGCTGG - Intronic
963984298 3:151574315-151574337 CAGGGAGAATGGAACCAAGCTGG - Intergenic
964123970 3:153216868-153216890 AAATGAGCATGGAAGGAAACGGG - Intergenic
964550667 3:157880884-157880906 CAGGGAGAATGGAACCAAGCTGG + Intergenic
964904994 3:161708609-161708631 CAGGGAGAATGGAACCAAGCTGG + Intergenic
965382509 3:168007313-168007335 TAGTGAGTATGGAGAGAAGTGGG + Intergenic
966842012 3:184097522-184097544 CAAAGAAGATGGAAGGAAGCTGG + Intronic
966990944 3:185229465-185229487 CAGTGAGTCTGGGGAGAAGCTGG + Exonic
967495508 3:190140046-190140068 GAGAGACAATGGAAGGAAGCTGG - Intergenic
967737668 3:192970464-192970486 CAGGGAGAATGGAACCAAGCTGG - Intergenic
968819362 4:2837922-2837944 CAGTGAGAATGGCTGGAAGATGG - Exonic
969164931 4:5299293-5299315 CAGTGAAAAGGGAAGGAAACAGG + Intronic
969232671 4:5842538-5842560 CAGGGAGTGTGGAAGGAGGAAGG - Intronic
969480832 4:7446057-7446079 CAGGGAGGAAGGAAGGAAGGGGG - Intronic
969747225 4:9082073-9082095 CAGTGAGAATGGAACCAAGTTGG + Intergenic
969969341 4:11029447-11029469 CAGAGGGTTTGGAAGGCAGCTGG + Intergenic
970444584 4:16113028-16113050 CAGTGAGGCTGGGAGGAAACAGG + Intergenic
971207504 4:24584414-24584436 CAGTTATTAAGGAAGAAAGCTGG + Exonic
971490364 4:27205800-27205822 CAGTGAGGCTGAAAGGAAGGAGG + Intergenic
972685751 4:41350990-41351012 CAGGGAGAATGGAACCAAGCTGG + Intergenic
972766889 4:42159466-42159488 CAGTGACGATGGAAGGAAGTGGG + Intergenic
972775059 4:42232657-42232679 CTGTGAGTAGCGAAGGGAGCCGG + Intergenic
973639773 4:52891352-52891374 CAGTGGGTAAGTAAGGAAGGTGG + Intronic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974491473 4:62570537-62570559 CAGGGAGCATGGAAGCAAGTTGG - Intergenic
975484026 4:74914791-74914813 CAGGGAGAATGGAAGCAAGTTGG - Intergenic
975518213 4:75270143-75270165 CAGGGAGAATGGAAGCAAGTTGG + Intergenic
976028380 4:80720038-80720060 CAGTGAGGATGGAGGAAACCAGG + Intronic
976202391 4:82592350-82592372 CAGAGAGATTGCAAGGAAGCTGG + Intergenic
976391719 4:84512398-84512420 CTGTGTGTACTGAAGGAAGCAGG + Intergenic
976494909 4:85716878-85716900 CAGCTAGCATGGAAGGAAACAGG + Intronic
976775133 4:88698804-88698826 CAGTGAGTGGGGAAGAAGGCGGG - Intronic
978060007 4:104326068-104326090 CAGGGAGAATGGAACCAAGCTGG - Intergenic
978187670 4:105876150-105876172 TAGAGAGAATGAAAGGAAGCCGG - Intronic
978205181 4:106072694-106072716 CAGGGAGAATGGAACCAAGCTGG - Intronic
978261100 4:106760421-106760443 CAGTAAGGATGGAAAGAAGATGG + Intergenic
978343202 4:107739029-107739051 CAGAAAGAATGGAAGGAAGCTGG + Intergenic
979583729 4:122390456-122390478 CAGAGAGAATGGAAACAAGCTGG - Intronic
979757750 4:124362779-124362801 CAGGGAGAATGGAACCAAGCTGG + Intergenic
980389956 4:132131688-132131710 CAGTGAGGATAGAAAGAAGATGG + Intergenic
980583571 4:134785763-134785785 CAGGGAGAATGGAACCAAGCTGG - Intergenic
981151037 4:141379311-141379333 CAGGGAGAATGGAACCAAGCTGG + Intergenic
981842226 4:149125765-149125787 CAGTGAGTGGGGTAGGAAGGGGG + Intergenic
982961196 4:161839054-161839076 CAGTGATTATAGGAGGAAACTGG + Intronic
983727094 4:170941809-170941831 CAGGGAGGATGGAAACAAGCTGG + Intergenic
983808427 4:172024852-172024874 CAGGGAGGAAGGAAGAAAGCAGG - Intronic
984092262 4:175388597-175388619 CAGGGAGAATGGAAACAAGCTGG + Intergenic
984335168 4:178380522-178380544 CAGAGAGGATGGAAACAAGCTGG + Intergenic
984903118 4:184602224-184602246 CAGAGAGAATGGAACCAAGCTGG + Intergenic
985450164 4:190057372-190057394 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
986277900 5:6296470-6296492 CAAAGAGTATAGTAGGAAGCAGG + Intergenic
986529869 5:8725303-8725325 CAGTTAGTATAGAATGAATCAGG - Intergenic
986787342 5:11126511-11126533 CATTGCGTATGGAAGAAAGCAGG - Intronic
987957110 5:24754386-24754408 CAGGGAGAATGGAACCAAGCTGG - Intergenic
988059650 5:26150065-26150087 CAGGGAGAATGGAATCAAGCTGG + Intergenic
988662459 5:33286516-33286538 CAGTGAGTATCTAAGGAATCTGG - Intergenic
988859265 5:35260560-35260582 CAGGGAGAATGGAACCAAGCTGG - Intergenic
990437458 5:55807916-55807938 CAGGGAGAATGGAAGAAAGTTGG - Intronic
991337783 5:65568661-65568683 CAGTGAGTATGGGAAGTAGGTGG + Intronic
992038716 5:72807633-72807655 CAGGGAGAATGGAACCAAGCTGG - Intergenic
992175612 5:74146299-74146321 CAGTCAGAAGGGAAGGAAGATGG - Intergenic
992479511 5:77136608-77136630 CAGTGTGTATGGCAGTAAGGTGG + Intergenic
992856289 5:80864914-80864936 CAGTGAGGATGAAAGCAAACTGG + Exonic
993052869 5:82945567-82945589 CAGGGAGAATGGAACCAAGCTGG + Intergenic
993546751 5:89221452-89221474 CAGGGAGAATGGAACCAAGCTGG + Intergenic
993578789 5:89634521-89634543 CAGGGAGAATGGAACCAAGCTGG - Intergenic
993621457 5:90173112-90173134 CAGTGGAAATGGAAGGAACCAGG - Intergenic
993656137 5:90580393-90580415 CAGGGAGAATGGAACCAAGCTGG - Intronic
993656191 5:90580850-90580872 CAGGGAGAATGGAACCAAGCTGG - Intronic
993916499 5:93749787-93749809 CATGAAGTATGGAAGGAAGGTGG + Intronic
994573965 5:101553069-101553091 CAGGGAGTATGGAACCAAGTTGG - Intergenic
994652461 5:102545855-102545877 AATTGAGTTTGGAAGGAAGCAGG + Intergenic
995003170 5:107159323-107159345 CAGGGAGAATGGAAACAAGCTGG + Intergenic
995441775 5:112200162-112200184 CATTGGGAATGGAAAGAAGCAGG - Intronic
995620774 5:114022791-114022813 CAGGGAGAATGGAACCAAGCTGG + Intergenic
995685197 5:114765187-114765209 CAGGGAGAATGGAAACAAGCTGG - Intergenic
996717701 5:126601057-126601079 CAGTGAGTGTGAAAGGAGGGTGG + Exonic
996893996 5:128457346-128457368 CAGGGAGAATGGAAACAAGCTGG + Intronic
997067674 5:130581147-130581169 CAGGGAGAATGGAAACAAGCCGG + Intergenic
997402662 5:133614021-133614043 AAATGAGTATAAAAGGAAGCAGG + Intergenic
997447350 5:133951416-133951438 CAGGGAGCATGGATGGAGGCAGG - Intergenic
998128521 5:139639525-139639547 CTGGGAGTATGGAAGGTAGCAGG - Intergenic
999531835 5:152471957-152471979 GAGTGATTATGCAAGGAAACTGG - Intergenic
1000357828 5:160417929-160417951 TAGTTAGTAGAGAAGGAAGCGGG - Intronic
1000932999 5:167274607-167274629 CAGTGACTCTGGAAGGCAGTTGG - Intergenic
1001277341 5:170360267-170360289 AAGTCACTGTGGAAGGAAGCAGG + Intronic
1002043477 5:176530081-176530103 CAGGAAGTAGGGCAGGAAGCTGG + Exonic
1002825642 6:771079-771101 CAGAGAGAAAGGAAGGAAGGAGG - Intergenic
1003113175 6:3265633-3265655 CAGGCAGTGTGGTAGGAAGCTGG - Intronic
1003117915 6:3295533-3295555 CAGGGAGGATGGAACAAAGCTGG + Intronic
1003170650 6:3719530-3719552 AAGTGAGTTAGGAAAGAAGCTGG + Intergenic
1003540267 6:7012515-7012537 CAGTGAGTCCTGAAGGAAGGAGG + Intergenic
1004070006 6:12289247-12289269 AAGTGAATATGCAAGGAAGGTGG - Intergenic
1004263985 6:14133139-14133161 CAGGGACTATGAAAGGAAGCAGG - Intronic
1005639180 6:27778524-27778546 CTGTAAGTATGGAAGGAGGAGGG - Intergenic
1007212581 6:40207246-40207268 CAATAAGTGTAGAAGGAAGCAGG - Intergenic
1008468091 6:51853520-51853542 CAGGGAGAATGGAAAAAAGCTGG - Intronic
1008864140 6:56189512-56189534 CAGGGAGAATGGAACCAAGCTGG + Intronic
1008969586 6:57351494-57351516 CTGTGAGAATGGAAAGAAGTGGG + Intronic
1009158558 6:60253331-60253353 CTGTGAGAATGGAAAGAAGTGGG + Intergenic
1010331461 6:74627867-74627889 CAGAGAGAATGGAAACAAGCTGG + Intergenic
1010615502 6:78007080-78007102 CGGGGAGAATGGAAGGAAGTTGG + Intergenic
1010670200 6:78677526-78677548 CAGGGAGAATGGAACCAAGCTGG + Intergenic
1011174261 6:84542362-84542384 CAGGGAGAATGGAATCAAGCTGG + Intergenic
1011855722 6:91688404-91688426 CAGAGAGGAAGGAAGGAAGGAGG - Intergenic
1011979223 6:93351323-93351345 CAGAGAGAAGGGAAGCAAGCAGG - Intronic
1012688286 6:102280446-102280468 CAATCATTATGGAAAGAAGCTGG - Intergenic
1013379765 6:109556603-109556625 CAGGGAGAATGGAAACAAGCTGG - Intronic
1013420544 6:109962735-109962757 CATTGAGAATGGAAGGAAGGTGG + Intergenic
1013606084 6:111750104-111750126 AAGTCAGAATGGAAGGAATCTGG - Intronic
1014367392 6:120561802-120561824 CAGGGAGAATGGAAACAAGCTGG - Intergenic
1015555768 6:134459842-134459864 CAGTGAGTGCAGAAGGAAGCGGG - Intergenic
1017523265 6:155220534-155220556 CAGTGAGGTTGGAAGGATGCAGG + Intronic
1017602618 6:156100250-156100272 CAATGAGTATGGAAAGGAGGGGG - Intergenic
1018015180 6:159705660-159705682 CAGGGAGAATGGAACCAAGCTGG + Intronic
1018695298 6:166386271-166386293 TGGTCAGTTTGGAAGGAAGCTGG + Intergenic
1019072305 6:169357854-169357876 CAGGGAGAATGGAACCAAGCTGG + Intergenic
1020097682 7:5377712-5377734 CAGTGAGTGTGGAAGGCCCCGGG - Intronic
1020349273 7:7200594-7200616 CAGGGAGAATGGAACCAAGCTGG - Intronic
1021902137 7:25296653-25296675 CAGAGAGTAAGGAAAGAAGTTGG - Intergenic
1022073915 7:26946881-26946903 CTGCCAGTATCGAAGGAAGCTGG + Intronic
1024099672 7:46016959-46016981 CAGGGAGAATGGAAACAAGCTGG + Intergenic
1024288345 7:47780250-47780272 CGGTGAGGAAGGAAGGAAGAAGG - Intronic
1024817358 7:53286922-53286944 CAGGGAGAATGGAACCAAGCTGG - Intergenic
1025720889 7:64011847-64011869 CAGGGAGAATGGAAGCAAGCTGG - Intergenic
1027577186 7:79945687-79945709 CAGGGAGAATGGAACCAAGCTGG - Intergenic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1028369189 7:90071494-90071516 CAGGGAGAATGGAACCAAGCTGG + Intergenic
1028639850 7:93029834-93029856 CAGTGACAATGGCAGGAAGGTGG - Intergenic
1028801241 7:94968738-94968760 CAGGGAGAATGGAACCAAGCTGG - Intronic
1028991878 7:97057735-97057757 CAGGGAGAATGGAAACAAGCTGG + Intergenic
1029848730 7:103440971-103440993 CACTGTGTATGGAAGGCTGCAGG + Intronic
1030124205 7:106139180-106139202 CGGTGAGTTTGGAAGGGAGCAGG + Intergenic
1030166285 7:106559046-106559068 CAGGGAGAATGGAACCAAGCTGG - Intergenic
1030890603 7:114994946-114994968 CAGGGAGAATGGAACCAAGCTGG - Intronic
1033111634 7:138583669-138583691 CAGTGTGTGTGGAAGGCAGTGGG + Intronic
1033149209 7:138898551-138898573 CAGTGAGTCATGCAGGAAGCTGG - Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033879572 7:145863766-145863788 CAGGGAGAATGGAAACAAGCTGG + Intergenic
1033887671 7:145968084-145968106 CAGGGAGAATGGAACCAAGCTGG + Intergenic
1034723829 7:153317198-153317220 CAGGGAGAATGGAATCAAGCTGG - Intergenic
1035084831 7:156249176-156249198 CCATGAGTAAGGAAGGAAGGAGG + Intergenic
1035483967 7:159208027-159208049 CAATGAGGATGGCAGGAAGTGGG + Intergenic
1035682236 8:1496474-1496496 CCTTGAGAAGGGAAGGAAGCAGG - Intergenic
1036465400 8:8992685-8992707 CAGAGAAAAAGGAAGGAAGCAGG + Intergenic
1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG + Intergenic
1038069087 8:23993373-23993395 CAGTGGGTTTGGAAGGCTGCAGG - Intergenic
1038531509 8:28321548-28321570 AAGTAAGGATGGAAGGAAGAAGG - Intronic
1040602435 8:48897741-48897763 CAGTGATTCTGGAGGGAGGCAGG - Intergenic
1040959931 8:53020653-53020675 CAGGGAGAATGGAACCAAGCTGG + Intergenic
1040976734 8:53201593-53201615 CAGGGAGAATGGAACCAAGCTGG + Intergenic
1041418927 8:57645584-57645606 CAGGGAGAATGGAACCAAGCTGG - Intergenic
1041508865 8:58632524-58632546 CAGTGAGGTTGGAGAGAAGCAGG - Intronic
1041568906 8:59313574-59313596 CAGAGAGGGTGGAAGGAAGATGG - Intergenic
1042319225 8:67457532-67457554 CAGAGAGGATGGAAAGAAGAAGG - Intronic
1042348849 8:67755633-67755655 CAGGGAGAATGGAACCAAGCTGG - Intergenic
1042928569 8:73991469-73991491 CAGTAAATATGGAAGAAAACAGG - Exonic
1043535883 8:81204014-81204036 CAGGGAGAATGGAACCAAGCTGG - Intergenic
1043870157 8:85423444-85423466 CAGGGAGAATGGAACCAAGCTGG - Intronic
1043931578 8:86097787-86097809 CAGTAAGTATTTAATGAAGCTGG - Intronic
1044077778 8:87844812-87844834 TAGAGAGTATGGAAGGCAACAGG + Intergenic
1044282904 8:90376962-90376984 CAGGGAGAATGGAACCAAGCTGG + Intergenic
1044517074 8:93151994-93152016 CAGTGAGCATGGATGGTTGCTGG + Intronic
1044784474 8:95780072-95780094 GAATGAGTATAGAAGGAGGCAGG + Intergenic
1045288097 8:100809582-100809604 GAGTGACTCAGGAAGGAAGCCGG - Intergenic
1046383818 8:113483803-113483825 CAGAGAGTGGGGAAGGAAGTGGG - Intergenic
1046702867 8:117420198-117420220 CAGGGAGAATGGAACCAAGCTGG + Intergenic
1046812745 8:118550071-118550093 CAGGGAGAATGGAACCAAGCTGG + Intronic
1046972379 8:120237207-120237229 CAGGGAGAATGGAACGAAGTTGG - Intronic
1047054711 8:121151276-121151298 CAGTCAGTATGTAAGGAACCAGG - Intergenic
1047095287 8:121618435-121618457 TAGTGAGTGTGGAAGGAATAAGG - Intronic
1047524090 8:125617723-125617745 AGGTGAGTCTGGAAGGAGGCTGG + Intergenic
1047905108 8:129464572-129464594 CAAAAAGTATGGAAAGAAGCTGG + Intergenic
1050374013 9:4952309-4952331 CAGGGAGAATGGAACCAAGCTGG - Intergenic
1050982480 9:12037373-12037395 CAGGGAGAATGGAAACAAGCTGG + Intergenic
1052014628 9:23450767-23450789 TAGTGAGTAAACAAGGAAGCGGG - Intergenic
1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG + Intronic
1053417846 9:37957964-37957986 AAGGGAGTTGGGAAGGAAGCTGG + Intronic
1055418636 9:76111723-76111745 AAATGAGTATGCAAGGAAGCAGG + Intronic
1055572811 9:77633641-77633663 CAGAGAGGATGGCAAGAAGCGGG + Intronic
1055716978 9:79128512-79128534 ATGTTAGTATGGAAGGAAGCTGG - Intergenic
1056182849 9:84102389-84102411 CAGTGAGGAGGGAAAGAAGGAGG + Intergenic
1057762494 9:97888153-97888175 CAGGGAGTATTGAAGGATGCAGG + Intergenic
1058517292 9:105789675-105789697 CAGGGAGAATGGAACCAAGCTGG - Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059094284 9:111395836-111395858 CAGTTTGTATAGAAGGAAGGAGG - Intronic
1059869649 9:118557886-118557908 CAGTGAATGTGGAAGAAACCAGG + Intergenic
1060231344 9:121827592-121827614 CAGTGAGTGTGGGGGGACGCGGG + Intronic
1060237050 9:121871856-121871878 CTTTGAGTGTGGAAGGGAGCTGG - Intronic
1061806184 9:133138968-133138990 CAGTGAGTGTGGGAGGGAGTGGG - Intronic
1061947352 9:133916148-133916170 CAGGGAGAATGGAGGGAAGGAGG + Intronic
1062130373 9:134889462-134889484 CAGTCAGTATGTCAGGAGGCTGG + Intergenic
1185920531 X:4087158-4087180 CAGTGAGTATTGATGGAATTTGG - Intergenic
1186108534 X:6230950-6230972 CATTGAGTATGAAAAGAAGGTGG + Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1187453360 X:19418581-19418603 CAGAGAGAATGGAACCAAGCTGG + Intronic
1187500181 X:19832908-19832930 CAGTGACTGTGGAGGGAACCAGG - Intronic
1189192061 X:39118847-39118869 CAGTGAGGGAGGAGGGAAGCAGG + Intergenic
1190259802 X:48790729-48790751 GAGAGAGAATGGAAGGAAGAAGG + Intronic
1190550733 X:51577188-51577210 CGGAGAGAATGGAAGCAAGCTGG + Intergenic
1190942683 X:55057490-55057512 CAGTGAGAATGGAAGGCGGCAGG - Intergenic
1191088568 X:56596271-56596293 CAGGGAGAATGGAAACAAGCTGG - Intergenic
1191716133 X:64194793-64194815 CACTGAGCATGGAAAGAGGCTGG + Intronic
1191767841 X:64719817-64719839 CAGTCAGGATGGAAAGAAGGTGG - Intergenic
1192026507 X:67457981-67458003 CAGGGAGAATGGAAACAAGCTGG + Intergenic
1192277328 X:69647290-69647312 CAGGGAGAATGGAACCAAGCTGG - Intronic
1192703023 X:73496634-73496656 CAGGGAGAATGGAAGCAAGCTGG - Intergenic
1193780648 X:85697789-85697811 CAGGGAGAATGGAAACAAGCTGG - Intergenic
1194202971 X:90977723-90977745 CAGGGAGAATGGAAGCAAGTTGG - Intergenic
1194203697 X:90985049-90985071 CAGGGAGAATGGAAGCAAGTTGG + Intergenic
1194653898 X:96548311-96548333 CACTGCATATGGCAGGAAGCAGG + Intergenic
1194773656 X:97936005-97936027 CAGAGAATATGGAATAAAGCAGG + Intergenic
1195084366 X:101400366-101400388 TAGTGAAGATGGAAGGAAGTGGG + Intronic
1195125949 X:101810285-101810307 CAGGGAGAATGGAACCAAGCTGG - Intergenic
1195658801 X:107358728-107358750 GAGTGAGGAAGGAAGGAAGAAGG + Intergenic
1195772508 X:108366555-108366577 CAGTGAGAATGGTAGGGGGCAGG - Intronic
1195928060 X:110046224-110046246 CAGTGAGAATGAAAAGAGGCAGG + Intronic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1197708543 X:129650660-129650682 CAGTAAGTATGGATGGAACAAGG + Intronic
1199011981 X:142769059-142769081 CAGGGAGAATGGAAGCAAGTTGG - Intergenic
1200249843 X:154547046-154547068 CAGCGGGTATGGCAGGCAGCCGG - Exonic
1200416900 Y:2921496-2921518 CAGGGAGAATGGAACCAAGCTGG - Intronic
1200548807 Y:4553149-4553171 CAGGGAGAATGGAAGCAAGTTGG - Intergenic
1200549531 Y:4560496-4560518 CAGGGAGAATGGAAGCAAGTTGG + Intergenic
1201462420 Y:14240855-14240877 CAGGGAGAATGGAACCAAGCCGG + Intergenic
1202249630 Y:22856347-22856369 CAGGGAGAATGGAACCAAGCTGG + Intergenic
1202402617 Y:24490095-24490117 CAGGGAGAATGGAACCAAGCTGG + Intergenic
1202468165 Y:25179988-25180010 CAGGGAGAATGGAACCAAGCTGG - Intergenic