ID: 1103256000

View in Genome Browser
Species Human (GRCh38)
Location 12:119541966-119541988
Sequence CTTAACACCTAGAACTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103256000_1103256004 5 Left 1103256000 12:119541966-119541988 CCAACCAAGTTCTAGGTGTTAAG 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1103256004 12:119541994-119542016 AGCAATGAACAAGGCAGACAAGG 0: 2
1: 5
2: 31
3: 167
4: 748
1103256000_1103256003 -4 Left 1103256000 12:119541966-119541988 CCAACCAAGTTCTAGGTGTTAAG 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1103256003 12:119541985-119542007 TAAGGATACAGCAATGAACAAGG 0: 2
1: 2
2: 10
3: 82
4: 551
1103256000_1103256005 20 Left 1103256000 12:119541966-119541988 CCAACCAAGTTCTAGGTGTTAAG 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1103256005 12:119542009-119542031 AGACAAGGTCTCTGTTCTCATGG 0: 1
1: 12
2: 92
3: 426
4: 1691

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103256000 Original CRISPR CTTAACACCTAGAACTTGGT TGG (reversed) Intergenic
902681718 1:18048470-18048492 CTTTGCACCTAGAACTTTCTGGG - Intergenic
905117000 1:35650830-35650852 CTTGACATTTATAACTTGGTGGG - Intergenic
908560701 1:65303208-65303230 CTGAACACCTATTACTTGGCAGG + Intronic
909345420 1:74579651-74579673 CTTAAAAGCAAGAACTTGGCTGG + Intronic
911199743 1:95032512-95032534 CTTTTCACCTAGAACATGTTAGG - Intronic
912090830 1:106073218-106073240 CTTAGAACTTAGAACTTAGTGGG - Intergenic
918614953 1:186533373-186533395 TTTAACAACTAGCACTTAGTAGG - Intergenic
922697553 1:227738904-227738926 CTGAGCCCCTAGGACTTGGTGGG + Intronic
923041750 1:230324620-230324642 CTTACCACTTAGAACAGGGTTGG - Intronic
924464177 1:244285204-244285226 CTGAACACCTGGAACTCTGTGGG + Intergenic
924783448 1:247172681-247172703 CTTAGCACCTAGAATGTGGCTGG - Intergenic
1063074246 10:2699392-2699414 CTTAATAGCTAGACCCTGGTGGG + Intergenic
1064554527 10:16535133-16535155 CTTAACACATACAACCAGGTTGG + Intergenic
1065780059 10:29159054-29159076 CTGGGTACCTAGAACTTGGTTGG + Intergenic
1066166368 10:32792502-32792524 CTTAAAACCTAGATGTTGGCTGG + Intronic
1072340881 10:94448273-94448295 CATAACACTTAGAACATGTTGGG + Intronic
1072374521 10:94800956-94800978 CTTAACACCTTGCACTTCCTGGG + Intronic
1073394261 10:103205425-103205447 CCTGACACCTAGATCATGGTGGG - Intergenic
1073894034 10:108133216-108133238 GTTCACAATTAGAACTTGGTGGG - Intergenic
1074323072 10:112421454-112421476 CTTAAAACCTTGAACTTGGAGGG - Intronic
1074778318 10:116782799-116782821 CTTAAGACGTAGAACATTGTTGG - Intergenic
1074874775 10:117605162-117605184 CTTAAAATCTATGACTTGGTTGG - Intergenic
1077924580 11:6668045-6668067 CTTTACAGCGAGAACCTGGTGGG + Intergenic
1078114488 11:8432070-8432092 CCTAGCACCTAGTACCTGGTAGG + Intronic
1078494072 11:11798540-11798562 CTTAACACCTAGTATATGGTAGG + Intergenic
1081228593 11:40556307-40556329 CATAACAAACAGAACTTGGTAGG - Intronic
1081695390 11:45105839-45105861 CTTAGCACCAAGCACTTTGTAGG - Intronic
1084511859 11:69610813-69610835 CTTAACTGCAAGTACTTGGTTGG + Intergenic
1095114090 12:38331556-38331578 CTGATCACCTTGAACTTGTTGGG + Intergenic
1096279867 12:50243739-50243761 CTTAACACATGGAACTGGTTTGG - Intronic
1097427952 12:59470775-59470797 CTTAAAACCTAGATGTTGGGTGG - Intergenic
1098076504 12:66737770-66737792 CATAACACCTGGCACCTGGTGGG - Intronic
1098815908 12:75162021-75162043 CTTAACACTTGGCTCTTGGTGGG - Intronic
1098840220 12:75468959-75468981 CTTAAAACATAGAATTTGATGGG - Intergenic
1102757530 12:115355046-115355068 CACAATACCTAGAACATGGTAGG - Intergenic
1102777616 12:115534184-115534206 CTTAACAACTAGTATTTAGTAGG + Intergenic
1103256000 12:119541966-119541988 CTTAACACCTAGAACTTGGTTGG - Intergenic
1105066783 12:133207969-133207991 ATTAACTCCTGTAACTTGGTAGG + Intergenic
1105444168 13:20438202-20438224 CTTAGCACATAAAACCTGGTGGG + Intronic
1110370816 13:74738045-74738067 GTTAAGACCTAGAATTTGGCTGG + Intergenic
1110838132 13:80108752-80108774 CTTAACACCTATTACGTGGCAGG + Intergenic
1112930920 13:104737063-104737085 CTCAACACGTAGGACTTGATTGG + Intergenic
1114413749 14:22525097-22525119 TTTTACACCTAGAAGATGGTGGG + Intergenic
1118830110 14:69422828-69422850 CTTAAAAACTACAACTAGGTGGG - Intronic
1119044579 14:71307241-71307263 CTCAACACCTAGCAATTGATTGG + Intergenic
1120592096 14:86388456-86388478 CTTAACACCTAAATTTTGGAGGG + Intergenic
1126624991 15:50677941-50677963 CTAAAGACCTAGAAATTGGCTGG + Intronic
1129168696 15:73794566-73794588 CTTAAGACCTTGAGCTTGGCTGG - Intergenic
1129321817 15:74779514-74779536 CTTCCCACCTAGCACTTAGTAGG + Intergenic
1129598810 15:76985284-76985306 CTTATCTCCTAGAAATTGTTTGG - Intergenic
1131863079 15:96675446-96675468 TTAAACACTTAGAACCTGGTAGG + Intergenic
1131956210 15:97739040-97739062 TTGAACACATAGAACTTAGTAGG + Intergenic
1131967859 15:97864434-97864456 CTTAACACCAAGAAGTATGTAGG + Intergenic
1133197425 16:4181441-4181463 CTTAACACCTAGAAGTGGCAGGG - Intergenic
1134828316 16:17302593-17302615 ATTAACACCTACACCATGGTGGG - Intronic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1136002931 16:27309798-27309820 GTTAAGACCCAGAACTTGGCTGG + Intergenic
1139367354 16:66441706-66441728 CTTGCCACCTTGCACTTGGTGGG - Intronic
1144487629 17:15680508-15680530 CGTGACTCCTAGAACATGGTTGG - Intronic
1144759509 17:17699506-17699528 CTGAACACCTAGTAATTGCTGGG + Intronic
1144913399 17:18701779-18701801 CGTGACTCCTAGAACATGGTTGG + Intronic
1145121780 17:20266878-20266900 CTCCACACCTAGGCCTTGGTGGG - Intronic
1145203268 17:20966384-20966406 CTCCACACCTAGGCCTTGGTGGG - Intergenic
1149691308 17:58579140-58579162 CTTAACATCTACCACTTGGGAGG - Intronic
1152509166 17:80773578-80773600 TTTTACACCGAGGACTTGGTTGG + Intronic
1158680109 18:59559442-59559464 CTTAACTCCCACAACTTGGCGGG - Intronic
1165979747 19:39710269-39710291 ATGAACACCTAGAAACTGGTGGG + Intergenic
1166575341 19:43832072-43832094 CATAAAACCTAGAACTGGGTTGG - Intronic
1166684479 19:44787864-44787886 CTGAAATCCTAGAACTTTGTGGG + Intronic
1167829522 19:52008136-52008158 CTTACTTCCCAGAACTTGGTGGG + Exonic
1168122175 19:54257580-54257602 CTGAAAACCTTGAACATGGTTGG - Intronic
1168334301 19:55588523-55588545 ATTAAGAACTAGAACTTTGTCGG + Intergenic
929666080 2:43835035-43835057 CTTATCACCTAGAACAGGGTCGG - Intronic
930217659 2:48713470-48713492 GTTAACATCAAGAACTGGGTAGG + Intronic
930511519 2:52351082-52351104 CTTCACACCCAGAACTGGATTGG - Intergenic
933079786 2:77971704-77971726 CAAAACACCAAGAACTTGGATGG - Intergenic
936847202 2:116851502-116851524 CTTAACACCTAGAATTTCTCTGG - Intergenic
938994386 2:136661834-136661856 CTTCACAGTTACAACTTGGTTGG - Intergenic
941384107 2:164832339-164832361 ATTAACACCAAGTAATTGGTAGG - Intronic
946330304 2:219005320-219005342 CTTGAGAAATAGAACTTGGTGGG - Intronic
947612939 2:231534965-231534987 CTTAACACCTACTCCCTGGTAGG - Intergenic
948067323 2:235090861-235090883 CTTGCCACCTAGACTTTGGTTGG + Intergenic
1171229117 20:23468143-23468165 CTTAAAATTTAAAACTTGGTGGG + Intergenic
1172576646 20:36014292-36014314 CTTAACACTTGGATCTTGGTTGG + Intronic
1175904243 20:62371881-62371903 CTAACCACCTACAACTTGGCAGG + Intergenic
1180010705 21:45049028-45049050 CTTAACATCTAGAACTGGAGAGG - Intergenic
1180016622 21:45090410-45090432 CTTAACACCTGGCTTTTGGTGGG + Intronic
1181823702 22:25495826-25495848 CATAAGACCCATAACTTGGTGGG - Intergenic
1182508835 22:30804121-30804143 GTTAACTCCTAGAACTGGATGGG + Intronic
949368947 3:3313787-3313809 CTTAGCAAATAGAAATTGGTTGG - Intergenic
950141859 3:10621142-10621164 CTTAGCACCTGGAGCTTGCTGGG + Intronic
950411072 3:12837935-12837957 CAAAACACCTAGAACTAGCTGGG + Intronic
950932760 3:16807351-16807373 TTTGTCATCTAGAACTTGGTAGG + Intronic
951399909 3:22219309-22219331 CTTAATACATAGAACAGGGTTGG - Intronic
953726050 3:45400015-45400037 CTTAACACTTAGAGGTTGTTTGG + Intronic
956067326 3:65411115-65411137 CTTAAAAAGTAGATCTTGGTAGG - Intronic
956299016 3:67749036-67749058 CTCAAGACCAAGAACTAGGTGGG - Intergenic
959382097 3:105653593-105653615 CTAAACACCTTGAACCTGATAGG + Intergenic
963007852 3:140742568-140742590 TTTAATACCTAAAACTTGGTAGG + Intergenic
964168232 3:153735119-153735141 CTTAGCACCCAGAATTTTGTTGG + Intergenic
969399721 4:6946185-6946207 CATAGCACCTAGAACATAGTTGG + Intronic
970206454 4:13660161-13660183 CTTAACAAATAGCAGTTGGTTGG - Intergenic
977169859 4:93748917-93748939 CTTAACATTTATTACTTGGTAGG - Intronic
979379337 4:119990436-119990458 CTTAAAACCTAGATGATGGTTGG + Intergenic
982476015 4:155851664-155851686 CTAAACACTTAGAACTTATTAGG + Intronic
987858911 5:23458323-23458345 TTTCACACTTAGACCTTGGTTGG - Intergenic
993570041 5:89525744-89525766 CTTAACACCTACAACTGGGCTGG + Intergenic
995191885 5:109326634-109326656 CTTCACAGCTAGAACGTGGTAGG + Intergenic
997335413 5:133105386-133105408 CTTAACACGTACAAATTGGCAGG - Exonic
998563084 5:143189890-143189912 CTTAGCACCTAGTACATGCTAGG - Intronic
1004603158 6:17170181-17170203 TTTAAGAGCTAGGACTTGGTAGG - Intergenic
1005598906 6:27406684-27406706 CTTAACTCCTACAACTTAGCAGG + Intergenic
1008796249 6:55306569-55306591 TTTAACACTTAGAATTTGGAGGG + Intergenic
1011705585 6:89997854-89997876 ATTAACAACCAGAACTGGGTAGG - Intronic
1014981383 6:127950113-127950135 CTTTATACCTAGAGCTTGGTGGG + Intergenic
1016109170 6:140200622-140200644 ATTAATACCTAGAACTAGGCTGG - Intergenic
1018050277 6:160003280-160003302 CTTAAAACCTAGAATTCTGTTGG + Intronic
1019455686 7:1125952-1125974 TTTAACACTCAGAACTTGGTGGG + Intronic
1020762857 7:12289828-12289850 TTTCACACCCACAACTTGGTAGG - Intergenic
1021799504 7:24290210-24290232 TTTAACACTTAGACATTGGTGGG - Intronic
1024967297 7:55035086-55035108 CTTAACACATAAGACTTGGGAGG + Intronic
1026372162 7:69711268-69711290 ATTAACATTTAGAACTGGGTAGG + Intronic
1026394896 7:69941469-69941491 CTTAACATTTGGAACTGGGTGGG + Intronic
1030690643 7:112529035-112529057 CTTGCCACCTACAACTGGGTGGG - Intergenic
1031710518 7:125040385-125040407 CTGAACATCTGGGACTTGGTTGG - Intergenic
1032948232 7:136876301-136876323 AGTAACAGCTAGAACTTGTTAGG + Intronic
1038469804 8:27805606-27805628 CCTACCACCCAGATCTTGGTTGG + Intronic
1044683516 8:94805264-94805286 CTTCACACCTATTACTTGGCAGG - Intergenic
1051271432 9:15359123-15359145 CTTGACATCTTGAACTTGGGAGG + Intergenic
1057766426 9:97923210-97923232 CTTAACCCCTAGCACATAGTAGG - Intergenic
1058919519 9:109599748-109599770 CTTAACACCCAGAGCCTGGCAGG + Intergenic
1185651522 X:1651421-1651443 CTTAACACCTTGAACATGTATGG + Intergenic
1186588786 X:10905599-10905621 TTTAAAATATAGAACTTGGTTGG - Intergenic
1192344402 X:70289461-70289483 CTTAACACCTAGATATGGGCTGG - Intronic
1197287138 X:124609088-124609110 CTTTACACCTATATCATGGTTGG - Intronic
1198118311 X:133566150-133566172 CTTTACACATAGAACTTGTCAGG + Intronic
1200978500 Y:9239280-9239302 CTTACCATTTAAAACTTGGTGGG + Intergenic