ID: 1103261449

View in Genome Browser
Species Human (GRCh38)
Location 12:119592970-119592992
Sequence GTGGGCTGGGAAGAAGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 468}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103261449_1103261460 30 Left 1103261449 12:119592970-119592992 CCTTGTTCTTCTTCCCAGCCCAC 0: 1
1: 0
2: 2
3: 38
4: 468
Right 1103261460 12:119593023-119593045 ATCTACCTGCATTTCTCCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 151
1103261449_1103261455 -1 Left 1103261449 12:119592970-119592992 CCTTGTTCTTCTTCCCAGCCCAC 0: 1
1: 0
2: 2
3: 38
4: 468
Right 1103261455 12:119592992-119593014 CTCATCCATCTAGGTTGCCTAGG 0: 1
1: 0
2: 0
3: 8
4: 83
1103261449_1103261451 -10 Left 1103261449 12:119592970-119592992 CCTTGTTCTTCTTCCCAGCCCAC 0: 1
1: 0
2: 2
3: 38
4: 468
Right 1103261451 12:119592983-119593005 CCCAGCCCACTCATCCATCTAGG 0: 1
1: 0
2: 2
3: 16
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103261449 Original CRISPR GTGGGCTGGGAAGAAGAACA AGG (reversed) Intergenic