ID: 1103261452

View in Genome Browser
Species Human (GRCh38)
Location 12:119592984-119593006
Sequence ACCTAGATGGATGAGTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103261452_1103261462 18 Left 1103261452 12:119592984-119593006 CCAGCCCACTCATCCATCTAGGT 0: 1
1: 0
2: 2
3: 22
4: 186
Right 1103261462 12:119593025-119593047 CTACCTGCATTTCTCCCCAGGGG 0: 1
1: 1
2: 1
3: 23
4: 202
1103261452_1103261464 27 Left 1103261452 12:119592984-119593006 CCAGCCCACTCATCCATCTAGGT 0: 1
1: 0
2: 2
3: 22
4: 186
Right 1103261464 12:119593034-119593056 TTTCTCCCCAGGGGTCCTGCAGG 0: 1
1: 0
2: 4
3: 30
4: 276
1103261452_1103261461 17 Left 1103261452 12:119592984-119593006 CCAGCCCACTCATCCATCTAGGT 0: 1
1: 0
2: 2
3: 22
4: 186
Right 1103261461 12:119593024-119593046 TCTACCTGCATTTCTCCCCAGGG 0: 1
1: 0
2: 0
3: 26
4: 202
1103261452_1103261465 30 Left 1103261452 12:119592984-119593006 CCAGCCCACTCATCCATCTAGGT 0: 1
1: 0
2: 2
3: 22
4: 186
Right 1103261465 12:119593037-119593059 CTCCCCAGGGGTCCTGCAGGTGG 0: 1
1: 0
2: 1
3: 44
4: 318
1103261452_1103261460 16 Left 1103261452 12:119592984-119593006 CCAGCCCACTCATCCATCTAGGT 0: 1
1: 0
2: 2
3: 22
4: 186
Right 1103261460 12:119593023-119593045 ATCTACCTGCATTTCTCCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103261452 Original CRISPR ACCTAGATGGATGAGTGGGC TGG (reversed) Intergenic