ID: 1103261454 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:119592989-119593011 |
| Sequence | AGGCAACCTAGATGGATGAG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 203 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 19, 4: 182} |
Found 5 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1103261454_1103261462 | 13 | Left | 1103261454 | 12:119592989-119593011 | CCACTCATCCATCTAGGTTGCCT | 0: 1 1: 0 2: 1 3: 19 4: 182 |
||
| Right | 1103261462 | 12:119593025-119593047 | CTACCTGCATTTCTCCCCAGGGG | 0: 1 1: 1 2: 1 3: 23 4: 202 |
||||
| 1103261454_1103261461 | 12 | Left | 1103261454 | 12:119592989-119593011 | CCACTCATCCATCTAGGTTGCCT | 0: 1 1: 0 2: 1 3: 19 4: 182 |
||
| Right | 1103261461 | 12:119593024-119593046 | TCTACCTGCATTTCTCCCCAGGG | 0: 1 1: 0 2: 0 3: 26 4: 202 |
||||
| 1103261454_1103261460 | 11 | Left | 1103261454 | 12:119592989-119593011 | CCACTCATCCATCTAGGTTGCCT | 0: 1 1: 0 2: 1 3: 19 4: 182 |
||
| Right | 1103261460 | 12:119593023-119593045 | ATCTACCTGCATTTCTCCCCAGG | 0: 1 1: 0 2: 0 3: 11 4: 151 |
||||
| 1103261454_1103261465 | 25 | Left | 1103261454 | 12:119592989-119593011 | CCACTCATCCATCTAGGTTGCCT | 0: 1 1: 0 2: 1 3: 19 4: 182 |
||
| Right | 1103261465 | 12:119593037-119593059 | CTCCCCAGGGGTCCTGCAGGTGG | 0: 1 1: 0 2: 1 3: 44 4: 318 |
||||
| 1103261454_1103261464 | 22 | Left | 1103261454 | 12:119592989-119593011 | CCACTCATCCATCTAGGTTGCCT | 0: 1 1: 0 2: 1 3: 19 4: 182 |
||
| Right | 1103261464 | 12:119593034-119593056 | TTTCTCCCCAGGGGTCCTGCAGG | 0: 1 1: 0 2: 4 3: 30 4: 276 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1103261454 | Original CRISPR | AGGCAACCTAGATGGATGAG TGG (reversed) | Intergenic | ||