ID: 1103261458

View in Genome Browser
Species Human (GRCh38)
Location 12:119593015-119593037
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 221}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103261458_1103261465 -1 Left 1103261458 12:119593015-119593037 CCAGCCTGATCTACCTGCATTTC 0: 1
1: 0
2: 1
3: 20
4: 221
Right 1103261465 12:119593037-119593059 CTCCCCAGGGGTCCTGCAGGTGG 0: 1
1: 0
2: 1
3: 44
4: 318
1103261458_1103261464 -4 Left 1103261458 12:119593015-119593037 CCAGCCTGATCTACCTGCATTTC 0: 1
1: 0
2: 1
3: 20
4: 221
Right 1103261464 12:119593034-119593056 TTTCTCCCCAGGGGTCCTGCAGG 0: 1
1: 0
2: 4
3: 30
4: 276
1103261458_1103261469 7 Left 1103261458 12:119593015-119593037 CCAGCCTGATCTACCTGCATTTC 0: 1
1: 0
2: 1
3: 20
4: 221
Right 1103261469 12:119593045-119593067 GGGTCCTGCAGGTGGAAAAGTGG 0: 1
1: 0
2: 4
3: 35
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103261458 Original CRISPR GAAATGCAGGTAGATCAGGC TGG (reversed) Intergenic