ID: 1103261460

View in Genome Browser
Species Human (GRCh38)
Location 12:119593023-119593045
Sequence ATCTACCTGCATTTCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 151}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103261457_1103261460 -9 Left 1103261457 12:119593009-119593031 CCTAGGCCAGCCTGATCTACCTG 0: 1
1: 0
2: 2
3: 38
4: 622
Right 1103261460 12:119593023-119593045 ATCTACCTGCATTTCTCCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 151
1103261450_1103261460 17 Left 1103261450 12:119592983-119593005 CCCAGCCCACTCATCCATCTAGG 0: 1
1: 0
2: 0
3: 12
4: 170
Right 1103261460 12:119593023-119593045 ATCTACCTGCATTTCTCCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 151
1103261449_1103261460 30 Left 1103261449 12:119592970-119592992 CCTTGTTCTTCTTCCCAGCCCAC 0: 1
1: 0
2: 2
3: 38
4: 468
Right 1103261460 12:119593023-119593045 ATCTACCTGCATTTCTCCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 151
1103261454_1103261460 11 Left 1103261454 12:119592989-119593011 CCACTCATCCATCTAGGTTGCCT 0: 1
1: 0
2: 1
3: 19
4: 182
Right 1103261460 12:119593023-119593045 ATCTACCTGCATTTCTCCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 151
1103261452_1103261460 16 Left 1103261452 12:119592984-119593006 CCAGCCCACTCATCCATCTAGGT 0: 1
1: 0
2: 2
3: 22
4: 186
Right 1103261460 12:119593023-119593045 ATCTACCTGCATTTCTCCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 151
1103261453_1103261460 12 Left 1103261453 12:119592988-119593010 CCCACTCATCCATCTAGGTTGCC 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1103261460 12:119593023-119593045 ATCTACCTGCATTTCTCCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 151
1103261456_1103261460 3 Left 1103261456 12:119592997-119593019 CCATCTAGGTTGCCTAGGCCAGC 0: 1
1: 0
2: 1
3: 10
4: 103
Right 1103261460 12:119593023-119593045 ATCTACCTGCATTTCTCCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103261460 Original CRISPR ATCTACCTGCATTTCTCCCC AGG Intergenic