ID: 1103261463

View in Genome Browser
Species Human (GRCh38)
Location 12:119593028-119593050
Sequence GGACCCCTGGGGAGAAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 235}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103261463_1103261474 27 Left 1103261463 12:119593028-119593050 CCTGCATTTCTCCCCAGGGGTCC 0: 1
1: 0
2: 4
3: 19
4: 235
Right 1103261474 12:119593078-119593100 TCCTTGTTTCCACACTGGGGAGG 0: 1
1: 0
2: 3
3: 12
4: 187
1103261463_1103261472 23 Left 1103261463 12:119593028-119593050 CCTGCATTTCTCCCCAGGGGTCC 0: 1
1: 0
2: 4
3: 19
4: 235
Right 1103261472 12:119593074-119593096 GAATTCCTTGTTTCCACACTGGG 0: 1
1: 0
2: 0
3: 19
4: 142
1103261463_1103261471 22 Left 1103261463 12:119593028-119593050 CCTGCATTTCTCCCCAGGGGTCC 0: 1
1: 0
2: 4
3: 19
4: 235
Right 1103261471 12:119593073-119593095 AGAATTCCTTGTTTCCACACTGG 0: 1
1: 0
2: 0
3: 13
4: 187
1103261463_1103261476 28 Left 1103261463 12:119593028-119593050 CCTGCATTTCTCCCCAGGGGTCC 0: 1
1: 0
2: 4
3: 19
4: 235
Right 1103261476 12:119593079-119593101 CCTTGTTTCCACACTGGGGAGGG 0: 1
1: 0
2: 1
3: 11
4: 183
1103261463_1103261473 24 Left 1103261463 12:119593028-119593050 CCTGCATTTCTCCCCAGGGGTCC 0: 1
1: 0
2: 4
3: 19
4: 235
Right 1103261473 12:119593075-119593097 AATTCCTTGTTTCCACACTGGGG 0: 1
1: 0
2: 0
3: 19
4: 200
1103261463_1103261469 -6 Left 1103261463 12:119593028-119593050 CCTGCATTTCTCCCCAGGGGTCC 0: 1
1: 0
2: 4
3: 19
4: 235
Right 1103261469 12:119593045-119593067 GGGTCCTGCAGGTGGAAAAGTGG 0: 1
1: 0
2: 4
3: 35
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103261463 Original CRISPR GGACCCCTGGGGAGAAATGC AGG (reversed) Intergenic