ID: 1103261464

View in Genome Browser
Species Human (GRCh38)
Location 12:119593034-119593056
Sequence TTTCTCCCCAGGGGTCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 276}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103261456_1103261464 14 Left 1103261456 12:119592997-119593019 CCATCTAGGTTGCCTAGGCCAGC 0: 1
1: 0
2: 1
3: 10
4: 103
Right 1103261464 12:119593034-119593056 TTTCTCCCCAGGGGTCCTGCAGG 0: 1
1: 0
2: 4
3: 30
4: 276
1103261454_1103261464 22 Left 1103261454 12:119592989-119593011 CCACTCATCCATCTAGGTTGCCT 0: 1
1: 0
2: 1
3: 19
4: 182
Right 1103261464 12:119593034-119593056 TTTCTCCCCAGGGGTCCTGCAGG 0: 1
1: 0
2: 4
3: 30
4: 276
1103261458_1103261464 -4 Left 1103261458 12:119593015-119593037 CCAGCCTGATCTACCTGCATTTC 0: 1
1: 0
2: 1
3: 20
4: 221
Right 1103261464 12:119593034-119593056 TTTCTCCCCAGGGGTCCTGCAGG 0: 1
1: 0
2: 4
3: 30
4: 276
1103261452_1103261464 27 Left 1103261452 12:119592984-119593006 CCAGCCCACTCATCCATCTAGGT 0: 1
1: 0
2: 2
3: 22
4: 186
Right 1103261464 12:119593034-119593056 TTTCTCCCCAGGGGTCCTGCAGG 0: 1
1: 0
2: 4
3: 30
4: 276
1103261459_1103261464 -8 Left 1103261459 12:119593019-119593041 CCTGATCTACCTGCATTTCTCCC 0: 1
1: 0
2: 0
3: 15
4: 246
Right 1103261464 12:119593034-119593056 TTTCTCCCCAGGGGTCCTGCAGG 0: 1
1: 0
2: 4
3: 30
4: 276
1103261450_1103261464 28 Left 1103261450 12:119592983-119593005 CCCAGCCCACTCATCCATCTAGG 0: 1
1: 0
2: 0
3: 12
4: 170
Right 1103261464 12:119593034-119593056 TTTCTCCCCAGGGGTCCTGCAGG 0: 1
1: 0
2: 4
3: 30
4: 276
1103261457_1103261464 2 Left 1103261457 12:119593009-119593031 CCTAGGCCAGCCTGATCTACCTG 0: 1
1: 0
2: 2
3: 38
4: 622
Right 1103261464 12:119593034-119593056 TTTCTCCCCAGGGGTCCTGCAGG 0: 1
1: 0
2: 4
3: 30
4: 276
1103261453_1103261464 23 Left 1103261453 12:119592988-119593010 CCCACTCATCCATCTAGGTTGCC 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1103261464 12:119593034-119593056 TTTCTCCCCAGGGGTCCTGCAGG 0: 1
1: 0
2: 4
3: 30
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103261464 Original CRISPR TTTCTCCCCAGGGGTCCTGC AGG Intergenic