ID: 1103261465

View in Genome Browser
Species Human (GRCh38)
Location 12:119593037-119593059
Sequence CTCCCCAGGGGTCCTGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 318}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103261459_1103261465 -5 Left 1103261459 12:119593019-119593041 CCTGATCTACCTGCATTTCTCCC 0: 1
1: 0
2: 0
3: 15
4: 246
Right 1103261465 12:119593037-119593059 CTCCCCAGGGGTCCTGCAGGTGG 0: 1
1: 0
2: 1
3: 44
4: 318
1103261457_1103261465 5 Left 1103261457 12:119593009-119593031 CCTAGGCCAGCCTGATCTACCTG 0: 1
1: 0
2: 2
3: 38
4: 622
Right 1103261465 12:119593037-119593059 CTCCCCAGGGGTCCTGCAGGTGG 0: 1
1: 0
2: 1
3: 44
4: 318
1103261453_1103261465 26 Left 1103261453 12:119592988-119593010 CCCACTCATCCATCTAGGTTGCC 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1103261465 12:119593037-119593059 CTCCCCAGGGGTCCTGCAGGTGG 0: 1
1: 0
2: 1
3: 44
4: 318
1103261458_1103261465 -1 Left 1103261458 12:119593015-119593037 CCAGCCTGATCTACCTGCATTTC 0: 1
1: 0
2: 1
3: 20
4: 221
Right 1103261465 12:119593037-119593059 CTCCCCAGGGGTCCTGCAGGTGG 0: 1
1: 0
2: 1
3: 44
4: 318
1103261454_1103261465 25 Left 1103261454 12:119592989-119593011 CCACTCATCCATCTAGGTTGCCT 0: 1
1: 0
2: 1
3: 19
4: 182
Right 1103261465 12:119593037-119593059 CTCCCCAGGGGTCCTGCAGGTGG 0: 1
1: 0
2: 1
3: 44
4: 318
1103261456_1103261465 17 Left 1103261456 12:119592997-119593019 CCATCTAGGTTGCCTAGGCCAGC 0: 1
1: 0
2: 1
3: 10
4: 103
Right 1103261465 12:119593037-119593059 CTCCCCAGGGGTCCTGCAGGTGG 0: 1
1: 0
2: 1
3: 44
4: 318
1103261452_1103261465 30 Left 1103261452 12:119592984-119593006 CCAGCCCACTCATCCATCTAGGT 0: 1
1: 0
2: 2
3: 22
4: 186
Right 1103261465 12:119593037-119593059 CTCCCCAGGGGTCCTGCAGGTGG 0: 1
1: 0
2: 1
3: 44
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103261465 Original CRISPR CTCCCCAGGGGTCCTGCAGG TGG Intergenic