ID: 1103261469

View in Genome Browser
Species Human (GRCh38)
Location 12:119593045-119593067
Sequence GGGTCCTGCAGGTGGAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 376}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103261459_1103261469 3 Left 1103261459 12:119593019-119593041 CCTGATCTACCTGCATTTCTCCC 0: 1
1: 0
2: 0
3: 15
4: 246
Right 1103261469 12:119593045-119593067 GGGTCCTGCAGGTGGAAAAGTGG 0: 1
1: 0
2: 4
3: 35
4: 376
1103261458_1103261469 7 Left 1103261458 12:119593015-119593037 CCAGCCTGATCTACCTGCATTTC 0: 1
1: 0
2: 1
3: 20
4: 221
Right 1103261469 12:119593045-119593067 GGGTCCTGCAGGTGGAAAAGTGG 0: 1
1: 0
2: 4
3: 35
4: 376
1103261457_1103261469 13 Left 1103261457 12:119593009-119593031 CCTAGGCCAGCCTGATCTACCTG 0: 1
1: 0
2: 2
3: 38
4: 622
Right 1103261469 12:119593045-119593067 GGGTCCTGCAGGTGGAAAAGTGG 0: 1
1: 0
2: 4
3: 35
4: 376
1103261456_1103261469 25 Left 1103261456 12:119592997-119593019 CCATCTAGGTTGCCTAGGCCAGC 0: 1
1: 0
2: 1
3: 10
4: 103
Right 1103261469 12:119593045-119593067 GGGTCCTGCAGGTGGAAAAGTGG 0: 1
1: 0
2: 4
3: 35
4: 376
1103261463_1103261469 -6 Left 1103261463 12:119593028-119593050 CCTGCATTTCTCCCCAGGGGTCC 0: 1
1: 0
2: 4
3: 19
4: 235
Right 1103261469 12:119593045-119593067 GGGTCCTGCAGGTGGAAAAGTGG 0: 1
1: 0
2: 4
3: 35
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103261469 Original CRISPR GGGTCCTGCAGGTGGAAAAG TGG Intergenic