ID: 1103261478

View in Genome Browser
Species Human (GRCh38)
Location 12:119593087-119593109
Sequence TCCAGGTGCCCTCCCCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 310}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103261478_1103261482 -9 Left 1103261478 12:119593087-119593109 CCACACTGGGGAGGGCACCTGGA 0: 1
1: 0
2: 2
3: 29
4: 310
Right 1103261482 12:119593101-119593123 GCACCTGGACGGGCATGGACCGG 0: 1
1: 0
2: 2
3: 13
4: 111
1103261478_1103261486 18 Left 1103261478 12:119593087-119593109 CCACACTGGGGAGGGCACCTGGA 0: 1
1: 0
2: 2
3: 29
4: 310
Right 1103261486 12:119593128-119593150 TGCCCACTGACTGACTATACTGG 0: 1
1: 0
2: 0
3: 8
4: 70
1103261478_1103261483 -8 Left 1103261478 12:119593087-119593109 CCACACTGGGGAGGGCACCTGGA 0: 1
1: 0
2: 2
3: 29
4: 310
Right 1103261483 12:119593102-119593124 CACCTGGACGGGCATGGACCGGG 0: 1
1: 0
2: 0
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103261478 Original CRISPR TCCAGGTGCCCTCCCCAGTG TGG (reversed) Intergenic
900362162 1:2294422-2294444 TCCCGCTGGCCTCCCCCGTGCGG + Intronic
900430268 1:2598063-2598085 GCGAGGCGCCCACCCCAGTGGGG - Intronic
900934088 1:5754391-5754413 TCAAGGTGCCCTCCCCCAGGCGG + Intergenic
901456706 1:9367248-9367270 CCCAGGTGCCCAGCCCAGGGTGG + Intronic
902616062 1:17624202-17624224 TCCATGTCCACACCCCAGTGGGG + Intronic
902636945 1:17740858-17740880 TCCGTGTGCCCTCACCAGGGAGG - Intergenic
903739800 1:25552168-25552190 ACCAGGTCCCCTACCCAGTCTGG - Intronic
904120805 1:28196538-28196560 GCCAGGTGCCCAGCACAGTGGGG - Intergenic
906146874 1:43565669-43565691 ACCGGGTGCCCTGCACAGTGCGG - Intronic
907865980 1:58399619-58399641 TCCAGGTCCACTCCGAAGTGAGG + Intronic
907886196 1:58594356-58594378 TCCATGTGGTCTCTCCAGTGGGG - Intergenic
908354843 1:63319175-63319197 TCCAGGTGGCTTTCCCAGCGGGG + Intergenic
908743863 1:67356415-67356437 CCCAGCTCTCCTCCCCAGTGAGG - Intronic
912485219 1:110021569-110021591 TCCAGGGCCCCTCCCCAGCCTGG - Intronic
912536016 1:110371726-110371748 TCCAGGTTCCCTGACCAGGGTGG - Intronic
912625713 1:111203745-111203767 GCCAGGTGCCCTTCAGAGTGTGG - Intronic
912675826 1:111679847-111679869 TTCAGATGCCCTGCCCAGAGAGG - Intronic
913070474 1:115293794-115293816 TCCCTGTGCCCTACACAGTGGGG + Intronic
916140576 1:161693584-161693606 CACAGATGCCCTGCCCAGTGAGG - Intergenic
916745479 1:167681898-167681920 TCTAGGAGCCCCTCCCAGTGGGG + Intronic
917193796 1:172445754-172445776 TCCATGTCCCCTTCCCAGAGTGG - Intronic
919981581 1:202645256-202645278 GACAGGTCCCCTCCTCAGTGTGG - Intronic
920045535 1:203129923-203129945 TGCTGGTGCCGTCCTCAGTGTGG + Intronic
920811341 1:209288710-209288732 TCCAGCTGCCATCACTAGTGGGG - Intergenic
920852717 1:209639444-209639466 TATTGGTGACCTCCCCAGTGAGG - Intronic
921675272 1:217969045-217969067 TCCAGGTATCCTCTCCACTGAGG + Intergenic
924451275 1:244181339-244181361 TCCAGGTCTCCTCCGCAGGGAGG - Intergenic
1063494603 10:6495296-6495318 CCTTGGTGCCTTCCCCAGTGTGG + Intronic
1063845562 10:10123698-10123720 AGCAGCTGCCCTTCCCAGTGTGG - Intergenic
1065176940 10:23086659-23086681 TCCAGTTGTAATCCCCAGTGTGG - Intergenic
1065972651 10:30817756-30817778 TCCTGGCCCTCTCCCCAGTGGGG - Intergenic
1066508144 10:36066428-36066450 TCCTGGTGCCCACTCCAGTGTGG + Intergenic
1067095647 10:43297777-43297799 TCCATGTGGCCTCCCCAGCATGG - Intergenic
1067662401 10:48246314-48246336 TCCAGGTGAGCTCCCAGGTGTGG - Intronic
1067762456 10:49058464-49058486 TCAATGTGCCCTTCCCAGGGAGG - Intronic
1068685754 10:59868567-59868589 ACCTGGTGCCCTCCCTACTGAGG + Intronic
1072748616 10:97959809-97959831 ACCAGGTGCCTTCCCTATTGAGG + Intronic
1072800112 10:98386962-98386984 TCCTGGTGACCTTCTCAGTGGGG + Intronic
1072871313 10:99124138-99124160 TCCAGGTCTCCTCTCCACTGAGG - Intronic
1073041860 10:100613223-100613245 CCCAGGTGCCCTGGCCAGCGAGG - Intergenic
1073072153 10:100801507-100801529 TCCAGGTGCTCTGTCCACTGTGG - Intronic
1074543425 10:114384794-114384816 TCCATGTGCCCACAGCAGTGCGG + Intronic
1075918264 10:126188427-126188449 TGCAGGTGCCCCACTCAGTGAGG - Intronic
1076842077 10:133050621-133050643 TGCAGGTTCCCTCCCCAGCCTGG + Intergenic
1077348394 11:2075805-2075827 GGCAGATGCCCTCCCCAGCGTGG - Intergenic
1078578135 11:12518287-12518309 TCCAGGTGGCCTGCCCATTTTGG + Intronic
1078660813 11:13283981-13284003 AAAAGGTCCCCTCCCCAGTGAGG - Intronic
1079011316 11:16830719-16830741 CCCAGGTGCCTGTCCCAGTGGGG - Intronic
1079837342 11:25350845-25350867 TCGAGAGGCCCTGCCCAGTGAGG + Intergenic
1079997014 11:27305372-27305394 TCCAGGTCTCCTCTCCACTGAGG + Intergenic
1080033575 11:27688092-27688114 CCCAGATGCCCTGCCCAGAGAGG + Intronic
1080605574 11:33862200-33862222 TCCAGGGTCCCTCCCCTCTGAGG - Intronic
1081011060 11:37812638-37812660 TCCGGGTGCTCACTCCAGTGTGG - Intergenic
1081627080 11:44662562-44662584 TCCTGGGGCCCTCCCCAGACAGG + Intergenic
1083421011 11:62553348-62553370 GCCAGCTCCCCTCCCCAGTGGGG + Intronic
1084660261 11:70542589-70542611 TCCCAGAGCCCTGCCCAGTGAGG - Intronic
1084980589 11:72826596-72826618 TCCAGGCAGCCTCCCCAGTCAGG - Intronic
1086437549 11:86797236-86797258 TCCCATTTCCCTCCCCAGTGGGG - Intronic
1087725360 11:101709354-101709376 GCCGGTTGCCCTCCCCAATGTGG - Intronic
1087808458 11:102582417-102582439 TCAAGGTGACCTTTCCAGTGTGG + Intronic
1089662211 11:119993005-119993027 TCAAGGCTCCCTCCCCTGTGTGG - Intergenic
1090799033 11:130159538-130159560 TCCAGGGGCCCTGCCCCGGGAGG - Intergenic
1091552406 12:1546515-1546537 TCCAGCTGCCCGTCCCAGTAGGG - Intronic
1091801310 12:3326406-3326428 TCCAGGTTCCCTCCCCTGGGAGG + Intergenic
1095406373 12:41870988-41871010 TTCAGATGCCCTGCCTAGTGAGG - Intergenic
1097084055 12:56454503-56454525 TCCAGGAGCCCAGCGCAGTGAGG + Exonic
1097320137 12:58216551-58216573 TCAGGCTGCCCTCCCCAATGTGG + Intergenic
1098193583 12:67976645-67976667 TAGAGATGCCCTGCCCAGTGAGG + Intergenic
1101816617 12:108150767-108150789 TCCAGGTGCCAAGCCCAGTGGGG + Intronic
1102544709 12:113646132-113646154 TCCAGGAGCCGTCCCCACAGAGG - Intergenic
1103261478 12:119593087-119593109 TCCAGGTGCCCTCCCCAGTGTGG - Intergenic
1103568080 12:121827077-121827099 CCCAAGTGCCCTCCCAGGTGAGG - Intronic
1103728915 12:123013206-123013228 TCCAGGTGCCCACCAGCGTGGGG + Intronic
1104349898 12:128035980-128036002 TCCTGGTGCCCTCCACAGCCAGG + Intergenic
1104600185 12:130148206-130148228 AACAGGTGCCTTCCTCAGTGGGG + Intergenic
1104897161 12:132169895-132169917 TCCAGCTGCCCTCCCCACCAGGG - Intergenic
1106193328 13:27473087-27473109 TCCAGGTGCACACCACAGAGGGG - Intergenic
1108577013 13:51799455-51799477 ACAGGGTGCCCTCCTCAGTGTGG + Intronic
1108840737 13:54611493-54611515 TGCTGGTGCCCTACCCAGAGGGG + Intergenic
1109314880 13:60738833-60738855 ACAAGTGGCCCTCCCCAGTGTGG + Intergenic
1110337307 13:74347038-74347060 TGCAGATGCCTTGCCCAGTGAGG - Intergenic
1111347233 13:86974609-86974631 TCCTTGTGCCCACTCCAGTGTGG + Intergenic
1112760434 13:102688770-102688792 TCCTGGTGCCCTGCCCTGTGAGG + Intronic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1113959567 13:114119094-114119116 TCCATGTGCCCTTCCCAGGCCGG - Intronic
1113994764 14:16056750-16056772 TCTCGGTGCCCTCCCCACTGGGG + Intergenic
1114486140 14:23062965-23062987 CCCAGGTGCCCTCCCCACCCCGG - Exonic
1116437694 14:44912623-44912645 TCCAAGTGCCCACCCCACTCAGG - Intergenic
1116707452 14:48320069-48320091 GCAGGTTGCCCTCCCCAGTGTGG - Intergenic
1116778046 14:49203901-49203923 ACCAGGTGCCTTCCCTACTGAGG + Intergenic
1116961576 14:50973142-50973164 TCCTGGTGCCCCCTCCAGGGTGG + Intergenic
1118665616 14:68065641-68065663 TCCAAGTGCCCTGCCCACAGGGG - Intronic
1119049951 14:71357466-71357488 TCCAGGAGCTTTTCCCAGTGTGG - Intronic
1120025399 14:79578257-79578279 TCCAGTTGCCCTCTCCCATGGGG + Intronic
1123129229 14:105972294-105972316 TCCAGGTGCCCCCCGGGGTGTGG - Intergenic
1202895371 14_GL000194v1_random:3473-3495 TCCAGGTGACATCCACAGTCTGG + Intergenic
1124497269 15:30193992-30194014 GACAGGTCCCCTCCTCAGTGTGG - Intergenic
1124592075 15:31062378-31062400 ACCAGGGGCCCTCCCCTGTGTGG + Intronic
1124633454 15:31350290-31350312 TCCAGGTGCCCTGCACGCTGGGG - Intronic
1124746305 15:32344655-32344677 GACAGGTCCCCTCCTCAGTGTGG + Intergenic
1124971802 15:34495972-34495994 TCCAGGTGGGCTCCCCCGGGCGG + Intergenic
1126101156 15:45119079-45119101 TCCAGGTGGCCTCCACGGGGAGG + Intronic
1127910353 15:63411354-63411376 TCCTGATGCCCACCCCGGTGAGG + Intergenic
1128579325 15:68797863-68797885 CCCTAGTGCCCTCCCCAGAGGGG + Intronic
1129232840 15:74206225-74206247 CCCAGCTGCCCTGCCCAGTCTGG + Intronic
1129823104 15:78617849-78617871 TCCACATGTCCTCCCCAGGGAGG - Intronic
1129883999 15:79026137-79026159 TTCAGGCCCCCTCCCCACTGAGG + Intronic
1129930916 15:79410415-79410437 TCCAAGTGCTCTCCCCAATTAGG - Intronic
1130980477 15:88808809-88808831 TCCAGTTGCCATGCCCAGTTGGG - Intronic
1132149429 15:99448797-99448819 TCCAGGTGCCGGTTCCAGTGGGG + Intergenic
1132203583 15:99971357-99971379 GCCAGGTGGCCACCACAGTGGGG + Intergenic
1132497701 16:271489-271511 GCCAGGTGCCTTCCCCAGCCCGG - Intronic
1132710374 16:1263639-1263661 GCCAGGGGCCCTCTGCAGTGGGG - Intergenic
1133444482 16:5848368-5848390 ACCGGGTGCCTTCCCCACTGAGG + Intergenic
1135808806 16:25568939-25568961 TCCAGGTCCCCTCTCCACAGTGG - Intergenic
1136465299 16:30438931-30438953 TCCAGGCTCCCTGTCCAGTGTGG + Intergenic
1136777866 16:32881265-32881287 TCTAGGAGCTCTCCTCAGTGGGG + Intergenic
1137331666 16:47504187-47504209 CCTAGGAGTCCTCCCCAGTGGGG + Intronic
1137538367 16:49344566-49344588 CCCAAGTGCCCACCCCACTGCGG + Intergenic
1137564478 16:49524694-49524716 GCCAGGCGTCCTCCCCAGGGTGG + Intronic
1137771941 16:51023549-51023571 TTAAGGTGCCCGCTCCAGTGAGG + Intergenic
1139281106 16:65771274-65771296 TCTAGGTGCCCTCTCCACAGCGG + Intergenic
1139510545 16:67425977-67425999 TCCAGGTGCCCAGCCCAGATGGG + Intergenic
1140022940 16:71256049-71256071 GCCAGCTCCCCTGCCCAGTGAGG + Intergenic
1140442735 16:74999638-74999660 TCCAGGTTCCCGCCCCACCGGGG + Exonic
1141675054 16:85513456-85513478 TGCAGGAGCCCCCCACAGTGGGG - Intergenic
1141698409 16:85631477-85631499 ACCATGTGCCCTCCCCATTGTGG + Intronic
1141796310 16:86277710-86277732 CCCAGCTGCTCTCCCCAGTAAGG + Intergenic
1144626720 17:16847676-16847698 CCCAGGAGGCCTCCTCAGTGAGG + Intergenic
1144663745 17:17088224-17088246 TCCTGGCTGCCTCCCCAGTGCGG - Intronic
1144879712 17:18425034-18425056 CCCAGGAGGCCTCCTCAGTGAGG - Intergenic
1145152523 17:20519351-20519373 CCCAGGAGGCCTCCTCAGTGAGG + Intergenic
1145796847 17:27660564-27660586 TCCAGGTGCCCTGTCTGGTGGGG + Intergenic
1146163853 17:30573512-30573534 CCCAGGAGGCCTCCTCAGTGAGG + Intergenic
1146183247 17:30710003-30710025 TCCCGGGCCCCTCGCCAGTGGGG - Intergenic
1146186732 17:30729105-30729127 ACCAGGTGTCCTGCCCTGTGGGG + Intergenic
1146552250 17:33791442-33791464 TCCAGTTCCCCTGCCCAATGGGG - Intronic
1147217911 17:38911652-38911674 CCCTGGTGCCCTTCCTAGTGGGG + Intronic
1147580862 17:41626366-41626388 CCCAGGAGGCCTCCTCAGTGAGG + Intergenic
1147612769 17:41811517-41811539 TCCAGGTGCCCTACCCGCCGCGG - Exonic
1148191933 17:45685280-45685302 TCCAGGCTACCTCCTCAGTGTGG + Intergenic
1148818981 17:50349344-50349366 CTGTGGTGCCCTCCCCAGTGTGG + Intronic
1149564543 17:57631634-57631656 TCCAGGTGTCCACCCCAGCCTGG + Intronic
1151018494 17:70584797-70584819 TCCAGCTCCCCTCTCCACTGAGG - Intergenic
1151619589 17:75237773-75237795 TCCTGCTGCCATCCCCAGGGAGG - Exonic
1151805564 17:76402886-76402908 CCCAGCTGCTCTTCCCAGTGAGG + Intronic
1152131993 17:78483160-78483182 TCCAGGCTCCCTCCTCAGAGTGG + Intronic
1152242639 17:79168240-79168262 CGCAGGTTCCCTGCCCAGTGGGG - Intronic
1153343489 18:4001858-4001880 TTCAGTTGCCCTTCCCAGAGTGG + Intronic
1153747348 18:8193560-8193582 GCCAGATGCCCTCCCCACAGGGG + Intronic
1155208536 18:23581287-23581309 GCCTGGTTCCGTCCCCAGTGTGG - Intronic
1156320563 18:36017515-36017537 TTCAAGTGCCCTCCACAATGTGG + Intronic
1156651667 18:39233513-39233535 TCCAGCTCCCCTCTCCACTGAGG - Intergenic
1160234629 18:77076343-77076365 CCCAGGTGGACTCCCCTGTGGGG - Intronic
1160764185 19:799831-799853 TCCAGGTCCCCTCCACAGCCAGG - Intronic
1161112895 19:2479540-2479562 CCCAGGTGCCCTCCCCTCTTGGG - Intergenic
1161684667 19:5696833-5696855 TCCAGGTGGCCTCTCCCCTGTGG - Intronic
1162972168 19:14187387-14187409 ACCAGGTGTCCTGCCCTGTGGGG - Intronic
1163382226 19:16976631-16976653 ACCAGCTGCCCTTCACAGTGTGG - Intronic
1163722932 19:18906793-18906815 TCCAGCTCCCCTGCCCAGTGTGG - Intronic
1164577277 19:29412932-29412954 ACCATGTGGACTCCCCAGTGTGG - Intergenic
1164874492 19:31673967-31673989 TCCAGAGGGCCTCCACAGTGGGG + Intergenic
1165752338 19:38267937-38267959 TCCTGGGGCCCTTCCAAGTGGGG - Intronic
1167508475 19:49883407-49883429 CCCTGGTGCCCTGTCCAGTGGGG + Intronic
1167930492 19:52859414-52859436 GACAGGTGCCCTCTCTAGTGAGG + Intergenic
1167946358 19:52992285-52992307 TCCAGGTGTCCTCCCTGCTGTGG + Intergenic
1167994784 19:53393635-53393657 TACAGGTGCCCTCTCTGGTGAGG - Intronic
925019809 2:559371-559393 TCCAGGTGCTCTCCTGGGTGAGG + Intergenic
926558996 2:14394708-14394730 TTCAGGTGCTCTCCGCAGGGAGG + Intergenic
926718482 2:15942193-15942215 TCCAGATGTCCTCCCCCGGGGGG - Exonic
927056519 2:19370403-19370425 GGAAGGTGCCCTCCCCAGTGGGG + Intergenic
927215097 2:20663957-20663979 TCCAGGTGCCCTGCCCAGTTGGG - Intergenic
927553223 2:24016600-24016622 TGCTGGTGCCCTTCCCTGTGTGG - Intronic
927843949 2:26461861-26461883 TGAAGTTGCCCTCGCCAGTGAGG + Exonic
929089279 2:38198786-38198808 TCCAGGCTACCTCGCCAGTGTGG + Intergenic
931687013 2:64802817-64802839 TAAAGTTGCCCTCACCAGTGTGG - Intergenic
932694981 2:73948412-73948434 TCCAGGTGCTATCTTCAGTGAGG + Intronic
934780136 2:96964745-96964767 TCCAGGAGCCCACTCCAGTCAGG + Intronic
934780791 2:96968473-96968495 TCCAGGTGCCCACCCTGGTTGGG + Intronic
934855617 2:97727581-97727603 TCCAGGGGCTCTCCCCAGGCTGG + Intronic
935283839 2:101545788-101545810 TCCATTTCCCCTCCCCAGAGAGG - Intergenic
935349852 2:102143407-102143429 ACAAGTTACCCTCCCCAGTGTGG - Intronic
935617796 2:105103503-105103525 TACAGGTGCCTTTCCCCGTGAGG + Intergenic
935667483 2:105525325-105525347 TCCTGGTGCCCACTCCAGTGTGG + Intergenic
935673655 2:105576179-105576201 GCCAGGTGCCCTGCTCAGTCAGG + Intergenic
935739903 2:106138397-106138419 TCCTGATGCTCTCCACAGTGTGG + Intronic
937259129 2:120574248-120574270 TCCAGGTCCCCTCCCTCTTGGGG - Intergenic
938536707 2:132254005-132254027 TCTCAGTGCCCTCCCCACTGGGG - Intronic
939101312 2:137897737-137897759 TCCAGCTCCCCTTCCCACTGAGG - Intergenic
939440873 2:142247722-142247744 TCTAAGTGCTCTCCCCAGTTTGG + Intergenic
941404743 2:165074532-165074554 TCCTGGTGCCCACTCCAGGGTGG + Intergenic
942114319 2:172713070-172713092 TCCAGGTCTCCTCTCCACTGAGG - Intergenic
948068173 2:235097697-235097719 GCCAGGTGCCATCTCCACTGTGG + Intergenic
948455229 2:238101671-238101693 TCCTGGGCCCGTCCCCAGTGTGG - Intronic
948456513 2:238106999-238107021 TTCTCGTGGCCTCCCCAGTGGGG + Intronic
948485818 2:238280092-238280114 CCCAGGTGCCCTCCCCAACAGGG + Intronic
948578104 2:238966845-238966867 TGCAGGTGCTCTCTCCCGTGGGG - Intergenic
948823817 2:240564680-240564702 TCCAGGTGCCCTCCACAGCCAGG - Intronic
1171036050 20:21713822-21713844 TCCAGATGCGCTCACCACTGTGG - Intronic
1171865603 20:30485780-30485802 TCTCGGTGCCCTCCCCACTGGGG - Intergenic
1172935205 20:38615374-38615396 CCCAGGTACCCACCCCAATGAGG + Intronic
1174058992 20:47819221-47819243 CCCATGTGCCACCCCCAGTGTGG + Intergenic
1174202118 20:48814048-48814070 TCCCTTTGCCCTCCCCAGTGTGG + Intronic
1175047900 20:56124742-56124764 TCCATGTGCTCTTCACAGTGGGG - Intergenic
1175539129 20:59737190-59737212 TCCAGAGGGCCGCCCCAGTGGGG - Intronic
1176281673 20:64316929-64316951 TCCACGTTCCCTCCCCACGGAGG + Intergenic
1176615068 21:9019460-9019482 TCCAGGTGACATCCACAGTCTGG + Intergenic
1177037376 21:16060678-16060700 TCCAGGTCTCCTCTCCACTGAGG - Intergenic
1179230560 21:39500271-39500293 CCCAGGAGCCCTGCCCAGTGGGG + Intronic
1179482316 21:41685995-41686017 GACAGGTGACCTCCACAGTGAGG + Intergenic
1180157052 21:45982898-45982920 TCCCGGCGCCCTCCAGAGTGAGG + Intronic
1180312328 22:11250659-11250681 TCTCGGTGCCCTCCCCACTGGGG - Intergenic
1181475802 22:23167159-23167181 TGCAGGTGCCCTCACCCCTGGGG + Intergenic
1181600936 22:23951602-23951624 TCAAGGCTCCCTCCCCAGTGGGG - Intergenic
1181607577 22:23989724-23989746 TCAAGGCTCCCTCCCCACTGGGG + Intergenic
1182424382 22:30264389-30264411 CCCCGGGGCCTTCCCCAGTGAGG - Exonic
1183473301 22:38021158-38021180 TCCTGGTGCCTTCCCCAGCCAGG - Intronic
1183489181 22:38107754-38107776 ACCAGATGCCCTTCCCAGGGAGG - Intronic
1184102028 22:42345728-42345750 GCCAGTTGCCCTCCTCACTGAGG + Intergenic
1184396593 22:44245615-44245637 TCCAGCTGCCATCCCCAGGCAGG - Exonic
1184583200 22:45430691-45430713 CCCAGCTGCCCTCCCCCGTCAGG - Intronic
1185281044 22:49970037-49970059 CACAGGTGGGCTCCCCAGTGGGG + Intergenic
950221831 3:11201964-11201986 TCCTGGTGCCTGCCCCGGTGAGG - Intronic
950768003 3:15288197-15288219 GCCGATTGCCCTCCCCAGTGTGG - Intronic
951557658 3:23936933-23936955 TCTAGGTGACTTTCCCAGTGAGG + Intronic
952161060 3:30693575-30693597 TCTAGGCACCCTCCTCAGTGTGG + Exonic
953385091 3:42501867-42501889 TCCAGGGCACCTCCCCAGGGAGG - Intronic
953492550 3:43363679-43363701 CCTAGGTGCCCTCCCCATGGGGG - Intronic
954005851 3:47589975-47589997 TCCAGAAGGCCTTCCCAGTGAGG - Intronic
956685022 3:71818337-71818359 TTCTTGTGCCCTCCCCACTGTGG + Intergenic
956791892 3:72686350-72686372 TGCAGGTGCCCTACCCTGGGTGG - Intergenic
956799399 3:72743303-72743325 TCCAGGGGCACTGCCCAGAGGGG + Intergenic
956980394 3:74629916-74629938 TACAGCTGCGCTTCCCAGTGTGG + Intergenic
957593109 3:82225691-82225713 GCCAGGAGCCCTGCCCAGTGAGG + Intergenic
958161295 3:89819027-89819049 TCCTGGTGCCCATTCCAGTGTGG - Intergenic
958584444 3:96068868-96068890 TCCAGGTCACCTCTCCACTGAGG - Intergenic
959453792 3:106534504-106534526 TAGAGATGCCCTGCCCAGTGAGG - Intergenic
961195810 3:125000441-125000463 CCAAGTTGTCCTCCCCAGTGAGG - Intronic
961390294 3:126548661-126548683 TCCAGGCTCCCTCCCCAGGTGGG - Intronic
962906227 3:139805493-139805515 TCCAGGTGCCCTTGCCAGGCTGG + Intergenic
963043034 3:141083187-141083209 CCCAGGTGCCCTCACTAGAGTGG + Intronic
966201149 3:177360236-177360258 TGCAGATGCCCTCCCCACTAGGG - Intergenic
967420819 3:189270517-189270539 CCCAGGTCCCCACGCCAGTGAGG + Intronic
968142934 3:196273629-196273651 TCCAGGTCTCCTCTCCACTGAGG - Intronic
968630073 4:1645734-1645756 TCCAGGAGCCATGCCCAGGGTGG - Intronic
973136562 4:46715572-46715594 GCAAATTGCCCTCCCCAGTGTGG + Intergenic
973246767 4:48017513-48017535 TCCAGGTTTCCTCTCCAGTACGG - Intronic
973893081 4:55387293-55387315 TCCAGGTCCCCTCTCCACTGTGG + Intergenic
975424948 4:74214890-74214912 CAGAGGTGCCCTGCCCAGTGAGG + Intronic
977323684 4:95549215-95549237 TCCGGGTCCCCTCGCCTGTGAGG + Intergenic
978271259 4:106893359-106893381 TCTAGAGGCCCTGCCCAGTGAGG - Intergenic
981337209 4:143581176-143581198 TCAAGAGGCCCTACCCAGTGAGG - Intronic
982092861 4:151895763-151895785 ACCTGGTGCCATCCCCACTGAGG - Intergenic
984172780 4:176380876-176380898 TTCAAGTGTCCTCCCCAGTGAGG + Intergenic
985771923 5:1817300-1817322 TCAAGGTATCTTCCCCAGTGGGG - Intergenic
987111065 5:14687312-14687334 TCCAGCAGCCCTCCTCAGGGTGG + Intronic
989117796 5:37972746-37972768 TCCAAGAGCCCTCACCAGTGGGG - Intergenic
990701889 5:58483020-58483042 TCCATATCCCCTCCCCAGCGAGG - Intergenic
993260465 5:85651541-85651563 TCCACTTCCACTCCCCAGTGTGG - Intergenic
994451504 5:99950309-99950331 TCCTGGCGCCCACTCCAGTGTGG + Intergenic
997352430 5:133240533-133240555 ACCAGGTGCTCTCCCCACAGTGG - Intronic
997469235 5:134107576-134107598 TCCTGGTGCCCTCCCCACCCTGG + Intergenic
997721641 5:136082622-136082644 TCCAGGTGCTCCCCCTGGTGGGG + Intergenic
1000698850 5:164422555-164422577 TCAAGAGGCCCTGCCCAGTGAGG + Intergenic
1002163609 5:177331753-177331775 CTCAGGAGCCCACCCCAGTGTGG + Exonic
1002568597 5:180127795-180127817 TGCAACTGCCCTCCCCACTGGGG + Intronic
1002782390 6:377365-377387 TTCAAGTCGCCTCCCCAGTGTGG - Intergenic
1003096699 6:3147988-3148010 GGCAGAGGCCCTCCCCAGTGTGG - Intronic
1004321429 6:14634422-14634444 TCCTGGTGCCCACATCAGTGAGG - Intergenic
1005795791 6:29360220-29360242 CAGAGATGCCCTCCCCAGTGAGG - Intronic
1005832328 6:29680868-29680890 TCCAGGTGCCCTGTCCACTGTGG - Intronic
1006272396 6:32974363-32974385 TCCAGGTGCTGGCCCTAGTGAGG - Intronic
1007731759 6:43951688-43951710 TCCAGGTGCTCTACCCTGGGTGG - Intergenic
1008418804 6:51273171-51273193 TCCATGTGCCCTTTCCTGTGAGG + Intergenic
1011101606 6:83728357-83728379 TCCAGGTGGCATCACCAGTCAGG - Intergenic
1011110166 6:83828794-83828816 TCTAGGTGACCTCCCCAGGAGGG - Intergenic
1012250644 6:96976343-96976365 TCCAGGTGCCCTGCCCAGAGAGG - Intronic
1012252196 6:96991829-96991851 TCTAGAGGCCCTGCCCAGTGAGG + Intronic
1013164231 6:107575399-107575421 TGGTGATGCCCTCCCCAGTGGGG + Intronic
1017874831 6:158515926-158515948 TGCAGATGCGCTCCCCAGAGAGG - Intergenic
1018344145 6:162882994-162883016 TCGAGGTGCCCCTGCCAGTGAGG - Intronic
1019146858 6:169981278-169981300 TCCTGCTGCCCACCCCAGAGGGG - Intergenic
1019183636 6:170208396-170208418 TCCAGGTGCCCTCTTCTTTGTGG - Intergenic
1020843605 7:13254521-13254543 GCAAATTGCCCTCCCCAGTGTGG + Intergenic
1023872482 7:44270241-44270263 TCCCAGTGCCCTCCCCAGCTGGG - Intronic
1025093963 7:56083666-56083688 TCAAGGTGACCTTCTCAGTGAGG + Exonic
1028412034 7:90540290-90540312 TCCAGGTGCCTACCACAGAGAGG - Intronic
1029600231 7:101559007-101559029 TAAAGGTGCTCTCCCCACTGTGG + Exonic
1029820163 7:103138995-103139017 TCCAGCTGCCTTCCCCAGGCTGG + Intronic
1030006186 7:105122974-105122996 TCCTGGTGACCAGCCCAGTGAGG + Intronic
1031406688 7:121395841-121395863 CCCAGGTGCCCGCCCCAGGCCGG + Intronic
1031893612 7:127323474-127323496 CCCAGGTGCCCTAGCCAGTATGG - Intergenic
1031994741 7:128222482-128222504 TCCAGGTGACCTGCACTGTGGGG + Intergenic
1034971254 7:155420716-155420738 AGCAGATGGCCTCCCCAGTGTGG + Intergenic
1037656430 8:20888022-20888044 TCCAGGAGCTATCCCCAGCGGGG - Intergenic
1041077181 8:54179246-54179268 TCCAGGTCCCCCACCCAGTCAGG - Intergenic
1042813741 8:72854997-72855019 TCTAGGAGGCCTTCCCAGTGGGG + Intronic
1044907139 8:97017133-97017155 TTCAGGTTCCCTCTCCAGTGGGG - Intronic
1045362925 8:101449597-101449619 TCCATGTGCCCTCTCCAGCATGG - Intergenic
1047105570 8:121727258-121727280 TCCAGGTGACCCCACCACTGTGG + Intergenic
1047214626 8:122866223-122866245 TCCCTGTTCCTTCCCCAGTGAGG + Intronic
1047624956 8:126647097-126647119 TAAAGTTGCCCTCACCAGTGTGG - Intergenic
1048972068 8:139650757-139650779 TGCAGGTGCTCTGCCCAGTGGGG + Intronic
1049257054 8:141619790-141619812 TCCAGGACCCCTCCCAAGAGAGG + Intergenic
1049354883 8:142182652-142182674 TCCCGGTGCCCTCCCCACGGTGG - Intergenic
1049872342 8:144990498-144990520 TAGAGATGCCCTGCCCAGTGAGG + Intergenic
1049925900 9:406814-406836 TTCGTGAGCCCTCCCCAGTGAGG - Intronic
1051355202 9:16234341-16234363 TCCAGGTCTCCTCTCCACTGAGG + Intronic
1052903676 9:33816783-33816805 TCTCGGGGCCCTCCCCACTGTGG - Intergenic
1053149833 9:35736405-35736427 GCTTCGTGCCCTCCCCAGTGAGG + Exonic
1053678376 9:40461468-40461490 GCCAGCTGGGCTCCCCAGTGAGG + Intergenic
1053928360 9:43089812-43089834 GCCAGCTGGGCTCCCCAGTGAGG + Intergenic
1054285348 9:63163479-63163501 GCCAGCTGGGCTCCCCAGTGAGG - Intergenic
1054291454 9:63297005-63297027 GCCAGCTGGGCTCCCCAGTGAGG + Intergenic
1054389472 9:64601544-64601566 GCCAGCTGGGCTCCCCAGTGAGG + Intergenic
1054457590 9:65443090-65443112 GCTTGGTGCCCTCCCCAGGGAGG + Intergenic
1054506243 9:65914827-65914849 GCCAGCTGGGCTCCCCAGTGAGG - Intergenic
1056193216 9:84205271-84205293 TCCCGGTGCCTTCCCTATTGAGG - Intergenic
1057281015 9:93711566-93711588 AACAGGTGGCCTCCCCAGTGTGG + Intergenic
1057336585 9:94160376-94160398 GCAAGTGGCCCTCCCCAGTGTGG - Intergenic
1057914351 9:99044209-99044231 TCCAGGATCCAGCCCCAGTGTGG - Intronic
1057990554 9:99765101-99765123 TACAGGTGCCCTCCACGTTGTGG - Intergenic
1059774527 9:117462307-117462329 TTCGGATGCCTTCCCCAGTGGGG - Intergenic
1060030923 9:120214110-120214132 TGCAGGTTCACTTCCCAGTGGGG + Intergenic
1061008433 9:127941684-127941706 TGCAGGTGCCCTCCCCAGGCTGG - Exonic
1061508961 9:131048943-131048965 TCCAGGTGCCAGCCCCAGGTGGG - Intronic
1061616759 9:131785374-131785396 TCCAGGTGACAGGCCCAGTGGGG - Intergenic
1061935661 9:133856361-133856383 GCCAGGAGCCCAGCCCAGTGAGG + Intronic
1188580804 X:31710591-31710613 TCGGGGTGTCCTCCCCAGTGAGG - Intronic
1188727842 X:33607314-33607336 TCCCGGTGCCCACTCCAGTGTGG - Intergenic
1190639032 X:52465248-52465270 CCCAATTGCCCTCTCCAGTGTGG + Intergenic
1190963705 X:55277807-55277829 CACAGATGCCCTGCCCAGTGAGG + Intronic
1190966386 X:55305404-55305426 CAGAGGTGCCCTGCCCAGTGAGG + Intergenic
1192317747 X:70065920-70065942 CCTGTGTGCCCTCCCCAGTGAGG - Intergenic
1193571694 X:83152110-83152132 TACAGATGTCCTGCCCAGTGAGG - Intergenic
1194090232 X:89576081-89576103 TGAAGGTGCACTCCACAGTGTGG - Intergenic
1194520188 X:94909219-94909241 TCAGGGTGTCCTACCCAGTGAGG - Intergenic
1195435889 X:104843091-104843113 TAGAGATGCCCTGCCCAGTGAGG + Intronic
1195532018 X:105968428-105968450 TCCAGCTGCCTCCCCAAGTGGGG + Intergenic
1198060538 X:133041895-133041917 CAAAGGTGCCCTGCCCAGTGAGG + Intronic
1199539799 X:148946305-148946327 TCAAGGTTCCCTTCCCAGGGTGG + Intronic
1200442883 Y:3232134-3232156 TGAAGGTGCACTCCACAGTGTGG - Intergenic