ID: 1103262841

View in Genome Browser
Species Human (GRCh38)
Location 12:119603484-119603506
Sequence TCACCTTGATGATTATTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103262841_1103262847 19 Left 1103262841 12:119603484-119603506 CCTTCAAATAATCATCAAGGTGA 0: 1
1: 0
2: 0
3: 13
4: 188
Right 1103262847 12:119603526-119603548 CCTAGAACTTTAATCACCTAAGG 0: 1
1: 0
2: 0
3: 9
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103262841 Original CRISPR TCACCTTGATGATTATTTGA AGG (reversed) Intronic
903401708 1:23057300-23057322 TTAACTTGAAGACTATTTGAAGG - Intronic
904863510 1:33558366-33558388 TCACTTTTATGAGTATTTCAGGG + Intronic
906812991 1:48848420-48848442 TCTCCTTAAAGGTTATTTGAAGG + Intronic
906959521 1:50409313-50409335 TCACATTTATGGTTAATTGAGGG + Intergenic
907927738 1:58970264-58970286 TCACCTTCAGGTTTATTTGCTGG - Intergenic
909335385 1:74466263-74466285 TTCCCTTGATTGTTATTTGATGG - Intronic
909433059 1:75612233-75612255 TCTCCTGGAAGATTATTTCAGGG - Intergenic
912112529 1:106360721-106360743 TCACCTTGATTATTTTTTGGGGG + Intergenic
916155912 1:161847612-161847634 TCACCTTGATGATCTCTTAACGG + Intronic
916578313 1:166086454-166086476 ACACCTTGAGCATTATTTGGTGG - Intronic
918368948 1:183839457-183839479 TCTTCTTTTTGATTATTTGATGG + Intronic
918447866 1:184632820-184632842 CCACCTTGTTGATTCATTGATGG + Intergenic
922144568 1:222926951-222926973 GCACCATGAGGATTATTTGGGGG + Intronic
923680052 1:236111775-236111797 TGACCTTGATGAGTATCTGCGGG - Intergenic
923976428 1:239269540-239269562 TCAACTTGTAGAATATTTGAAGG + Intergenic
924118812 1:240775401-240775423 TCACCTTGAAATTTATTTCAAGG - Intergenic
924449704 1:244166406-244166428 TCATCTTGATGGTGAGTTGAGGG - Intergenic
1065481983 10:26204643-26204665 TCACCTAGATGATAAGTTCATGG + Intronic
1066230486 10:33427924-33427946 TCATCTTGATCATCACTTGATGG + Intergenic
1066243681 10:33561786-33561808 TCACCATGATTATTGCTTGATGG + Intergenic
1067919531 10:50439364-50439386 TCAGCTTTCAGATTATTTGATGG - Intronic
1068373690 10:56151860-56151882 TATCGTTGATGTTTATTTGAGGG - Intergenic
1071185764 10:83042815-83042837 TCTCCTATATAATTATTTGATGG + Intergenic
1071245720 10:83760752-83760774 TGACCTTGATGTGTGTTTGATGG - Intergenic
1073739886 10:106394342-106394364 CCACATTGATGATTAGTTCAAGG + Intergenic
1074917405 10:117970958-117970980 TAACCTTGATGATCACTTGAAGG - Intergenic
1075967681 10:126626796-126626818 TCACCTTGATTTTTAAGTGAAGG + Intronic
1076145216 10:128113423-128113445 TCACCTTGATGATTTTCTTCAGG + Exonic
1077821570 11:5748423-5748445 TCATAATGATGATTATTTCAAGG + Intronic
1078717090 11:13850621-13850643 TGACTTTGATAATTATTTGGAGG - Intergenic
1081661162 11:44889282-44889304 TCTCCTTGAAGATGATTTCAGGG + Intronic
1083982247 11:66182145-66182167 TCTCCTTGATGATAATTTTCTGG - Intronic
1085104600 11:73831212-73831234 TGTCCTTGATGCTTTTTTGAGGG + Intronic
1086122976 11:83319396-83319418 TCATCTTGATGATCAGATGAAGG - Intergenic
1093373469 12:18393123-18393145 TTACCATGATTATTATTTGTTGG - Intronic
1095145741 12:38723658-38723680 TCACCTTTATTATATTTTGATGG - Intronic
1095828553 12:46557688-46557710 TCTCCTTGATCTTTATATGATGG + Intergenic
1096321756 12:50620291-50620313 TCAACTTGAAGATGATTTGTGGG + Intronic
1098765408 12:74482368-74482390 TTTCCTTGTTCATTATTTGAGGG + Intergenic
1099791804 12:87344776-87344798 TCACTTGAATTATTATTTGATGG - Intergenic
1100926426 12:99553745-99553767 GCACCTTGATTTTTATTTGCGGG + Intronic
1101461578 12:104901967-104901989 TCATTTTTATGATTATCTGAGGG - Intronic
1102834715 12:116044657-116044679 TCTACCTGATGATTATTTGCGGG - Intronic
1103262841 12:119603484-119603506 TCACCTTGATGATTATTTGAAGG - Intronic
1107371499 13:39755105-39755127 TGACTTTGATCATTTTTTGAAGG - Intronic
1108669129 13:52664806-52664828 ACACCTTAATTATTATTTCATGG - Intronic
1108853115 13:54760262-54760284 CCACATTTATGATTAGTTGAGGG - Intergenic
1110702516 13:78565760-78565782 AAACTTTGATGTTTATTTGATGG - Intergenic
1111216564 13:85150879-85150901 TCACAAAGATGATTATTTAATGG + Intergenic
1112151361 13:96768190-96768212 TTACCTTGATGATGCTTGGAAGG + Intronic
1113489593 13:110680728-110680750 TCCCCTTGCTGCTCATTTGAGGG - Intronic
1114514604 14:23290133-23290155 TCTCCTAGATGATGAGTTGACGG + Intronic
1114740323 14:25090251-25090273 TCAACTTAAATATTATTTGAAGG - Intergenic
1117557238 14:56898099-56898121 TAACCCTGATGATTTTTTGTCGG + Intergenic
1119361653 14:74055099-74055121 TCAACTTTATGATTTTGTGATGG + Intronic
1120293597 14:82609884-82609906 TTGCCTTCATGATTTTTTGAGGG + Intergenic
1202861542 14_GL000225v1_random:85838-85860 TCACCTGGGTGATCATTTCAGGG - Intergenic
1202864991 14_GL000225v1_random:110974-110996 TCACCTGGATGATTATTGCATGG + Intergenic
1126241687 15:46452242-46452264 TCTCCTTGTTTTTTATTTGAGGG + Intergenic
1127915143 15:63449159-63449181 TCACCTTGAATATTATTTGTTGG - Intergenic
1131890495 15:96966828-96966850 TTACCTTGATGTTTAAATGAAGG - Intergenic
1133678454 16:8097810-8097832 ACACATTGATTTTTATTTGAAGG - Intergenic
1133852983 16:9523682-9523704 TCAACTTGAGGATTTTTTCATGG - Intergenic
1135275854 16:21111992-21112014 TGACATTGATGATTTTGTGACGG - Exonic
1138051136 16:53779841-53779863 TCACCATGAAGATTAGATGAGGG - Intronic
1139008389 16:62601962-62601984 TTACCTTGAGGAATATTTGTAGG - Intergenic
1140912443 16:79466512-79466534 TCTCCTTGATGAGTATAAGACGG - Intergenic
1141604206 16:85143698-85143720 GCACCTTGACGATCATTGGAGGG + Intergenic
1141933852 16:87223164-87223186 TCACATTGATGCTTATATGATGG - Intronic
1143680901 17:8475290-8475312 TAGCATTGATCATTATTTGAAGG + Exonic
1147640692 17:41997175-41997197 CCACCTTGATGATGCTTGGAAGG - Exonic
1148358071 17:46989532-46989554 TGACCTTGATGATTAGCTCAGGG + Intronic
1153179937 18:2421643-2421665 TTCCCCAGATGATTATTTGAAGG + Intergenic
1153446400 18:5177854-5177876 TGACCTGGATGATTGTCTGAAGG + Intronic
1154413398 18:14156279-14156301 TTACATTGGTGATGATTTGATGG + Intergenic
1155077131 18:22368937-22368959 TCACCATGATGCTCATTTGTGGG + Intergenic
1155940371 18:31796282-31796304 TCACCATGATGATTTTCTGTTGG - Intergenic
1159078270 18:63706168-63706190 ACTCCTTAATGATTATTTTAGGG + Intronic
1159909177 18:74127787-74127809 TGACCTTGATGACCATTTCAGGG + Intronic
1159991995 18:74919809-74919831 CCAGCTTGCTGATTATTTCAGGG + Intronic
1160000713 18:75019053-75019075 TTAACCTGATGATTAATTGAGGG - Intronic
1160066315 18:75577568-75577590 TCACCTTGATGAGAAAGTGATGG - Intergenic
1162677810 19:12313439-12313461 ACACCTTCCTGTTTATTTGAAGG - Intergenic
1163807913 19:19411195-19411217 TCACCTTGCTCATTATTCGGCGG + Intronic
1164240306 19:23381802-23381824 TATCCATGATGATTATTTGCAGG - Intronic
926675254 2:15613203-15613225 TCATCTTGATATTTATTTCAGGG + Exonic
927904202 2:26845777-26845799 TCACCTGGATATTGATTTGATGG - Intergenic
931456546 2:62414015-62414037 TCACCTGGAACATTATTTGGAGG + Intergenic
933938879 2:87229094-87229116 TCACCTAGGTTATTATCTGAGGG - Intergenic
935312480 2:101799080-101799102 TCACCTTGAAAATTATTTATGGG - Intronic
936354258 2:111736681-111736703 TCACCTAGGTTATTATCTGAGGG + Intergenic
936996333 2:118417837-118417859 TCAGCTGGATGCTTATGTGATGG - Intergenic
937635886 2:124154725-124154747 TCCCATTGGTCATTATTTGATGG - Intronic
937746313 2:125420065-125420087 TGACCTGGATGACTAGTTGATGG + Intergenic
937746439 2:125421153-125421175 AAACCTGGATGATTAGTTGATGG + Intergenic
938738376 2:134207232-134207254 CCACCTTGATAATTATCTTAAGG + Intronic
939767547 2:146270104-146270126 TCACATTAATTATTATTTCATGG + Intergenic
944042574 2:195373003-195373025 ACAACTTGATGGTTATTTGATGG + Intergenic
945993259 2:216413950-216413972 TCACCTTTCTCATTATCTGATGG + Intronic
946768973 2:223068532-223068554 TTACCTGAATGATTATATGATGG + Intronic
947553216 2:231063471-231063493 TCACATTGCTGATTAGTAGAAGG + Intronic
948655351 2:239473537-239473559 CCCCCTTGATCATTATTAGAAGG + Intergenic
949021913 2:241745632-241745654 TCACCAGGATTATTATTTTATGG + Intronic
1168806030 20:672873-672895 TAACCTTGCTGAGCATTTGAGGG - Intronic
1169055272 20:2615763-2615785 TCTCCTTGATTATAATTTCAGGG + Intronic
1170196753 20:13696851-13696873 CCACATTGATGATAAATTGAGGG + Intergenic
1176703701 21:10092562-10092584 TGACATTGATGGTTATCTGATGG - Intergenic
1176859621 21:14001966-14001988 TTACATTGGTGATGATTTGATGG - Intergenic
1179139992 21:38716929-38716951 CCACCTTGATGATTAGGTCAGGG + Intergenic
951588551 3:24239482-24239504 TCATCATTATTATTATTTGATGG + Intronic
951839546 3:27019627-27019649 GTACCATGATGTTTATTTGAGGG + Intergenic
954607271 3:51922074-51922096 TAACCATGATTATTATGTGAAGG + Intergenic
959264749 3:104123021-104123043 TCACTTTGAAGATATTTTGAAGG - Intergenic
960170311 3:114453531-114453553 TCACCAAATTGATTATTTGATGG + Intronic
962193046 3:133331385-133331407 TCCCATTGTTGATTATTTTATGG + Intronic
971693356 4:29866580-29866602 TCACCTTTATCATTAGTTTAGGG - Intergenic
972357853 4:38298000-38298022 TCAAATTGATGTTTATGTGAGGG - Intergenic
972830691 4:42810530-42810552 TCAGCTTGAAGGTTATTTCATGG + Intergenic
973136862 4:46719538-46719560 TCACTTTTATGATTGTTTGGAGG - Intergenic
974284715 4:59848892-59848914 TCACCTTGATGGTTAATTTTAGG - Intergenic
974758609 4:66246446-66246468 TCACTTTGCTGATTATTACATGG - Intergenic
977391626 4:96416671-96416693 TCACCTTTTATATTATTTGATGG - Intergenic
977987819 4:103405154-103405176 TTACCTTGTTGCTTTTTTGAAGG + Intergenic
980375915 4:131948914-131948936 TGACTTTGATGGTTATCTGATGG - Intergenic
980763947 4:137274010-137274032 GCACCTTTATTATAATTTGAGGG + Intergenic
982023418 4:151228284-151228306 TCACATAGTTGATAATTTGAGGG + Intronic
983599860 4:169515211-169515233 TTATCTTGATGAATTTTTGATGG + Intronic
983801235 4:171931960-171931982 TCAGCTTTATCATTATTTAATGG + Intronic
986887600 5:12258882-12258904 TCATCTTTATTATTATTTAAAGG - Intergenic
987016885 5:13829602-13829624 TCACCCTTATGATAATCTGACGG + Exonic
987761510 5:22168794-22168816 TTACCTTGATTATTCTTTGAAGG - Intronic
988038229 5:25855081-25855103 TCACATTTAAGATTATTTGAAGG + Intergenic
990120543 5:52445538-52445560 TCACTTTCATGAAGATTTGAAGG + Intergenic
990528521 5:56651870-56651892 CCACCTTGGTGTTTATGTGATGG - Intergenic
991896298 5:71402261-71402283 TTACCTTGATTATTCTTTGAAGG - Intergenic
992866735 5:80964131-80964153 TCACTTTGATGAGTCTTTGGAGG + Intronic
994017167 5:94980854-94980876 TCTCCTTGATTATTAATTAAAGG + Intronic
995162758 5:109001200-109001222 TACCCTTGATGAACATTTGATGG + Intronic
996151389 5:120040089-120040111 TTACCGTAATGTTTATTTGATGG + Intergenic
996216990 5:120880519-120880541 ACACCAGAATGATTATTTGATGG - Intergenic
999705193 5:154266350-154266372 TAACAGTGATGATTATTGGATGG + Intronic
1000414936 5:160974603-160974625 TCACCTTACTGAAGATTTGAGGG + Intergenic
1002877950 6:1227604-1227626 CCACCTTGATGTTTGTTTCAAGG - Intergenic
1003124538 6:3345812-3345834 TCTACTTCATGATTATTTGGAGG - Intronic
1003443859 6:6167454-6167476 TGACCTTGATGATGATCTCAGGG + Exonic
1003801165 6:9668922-9668944 TCAAGATGATGAATATTTGATGG + Intronic
1004099723 6:12596686-12596708 TGACCTTGCTCATTATTTGGAGG - Intergenic
1004692449 6:18004076-18004098 CCACCATGATGAATATTTGGGGG - Intergenic
1009370462 6:62894198-62894220 TCACCTAGAAGAAAATTTGAGGG + Intergenic
1010108540 6:72196690-72196712 TCACTTTTATGAGTATTTTATGG - Intronic
1012786152 6:103629476-103629498 TCATCTTTATGATAAATTGAAGG - Intergenic
1014438173 6:121443298-121443320 TCACATTAAACATTATTTGATGG + Intronic
1016901800 6:149110030-149110052 TCACCTACATGAATATCTGATGG - Intergenic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1019961493 7:4464061-4464083 TCTCCTTCATGATGATTTGCAGG - Intergenic
1024938498 7:54737783-54737805 TTACCTTGGTGATGATTTAATGG - Intergenic
1029868351 7:103661021-103661043 TCACCTTGATGACTATTTTTGGG + Intronic
1030375719 7:108751119-108751141 GCACCATGATTATTATTTGATGG - Intergenic
1032374729 7:131400991-131401013 TCTCATTGATGATGATTTGTTGG + Intronic
1034773466 7:153802360-153802382 TCACCTTGAGCTTTATTTAAGGG + Intergenic
1035813917 8:2517531-2517553 TCAGCTTTATGATTTTCTGAGGG + Intergenic
1036928462 8:12930342-12930364 TTACCTTTATGGATATTTGAAGG - Intergenic
1038522883 8:28248404-28248426 TCATCTTGATCATTCTCTGAAGG - Intergenic
1039389309 8:37164460-37164482 TTACCTTGATGAATATTTTGAGG + Intergenic
1039674743 8:39649781-39649803 TCACCATCATAATTATCTGATGG - Intronic
1042720173 8:71819118-71819140 TCCCTATGATGATCATTTGAAGG - Intergenic
1043146529 8:76662423-76662445 TCACCATGATCTTTATTTGAAGG - Intergenic
1044129597 8:88505487-88505509 TCAACTTGATGTTTCTGTGAGGG - Intergenic
1044337182 8:91000492-91000514 TTACCTTCATTATTCTTTGATGG + Intronic
1044756659 8:95469812-95469834 TCCCCATGAGGAATATTTGAAGG + Intergenic
1044757183 8:95476307-95476329 ACACCTTGTAGATTATTTAAGGG - Intergenic
1045075820 8:98566807-98566829 TCTCCTTTTTGATTATTTCATGG - Intronic
1047197307 8:122733603-122733625 TCACCTTGATGATTAGACGTTGG + Intergenic
1050459198 9:5862750-5862772 TCACCTTGGTGATCAGTTGTGGG - Intergenic
1051446761 9:17148587-17148609 TGTGCTTGATGATCATTTGAAGG + Intronic
1051697423 9:19784099-19784121 TCATTTTTATGATTATTTTAAGG - Intronic
1051754267 9:20379398-20379420 TCACTATGATGATGATTTGGGGG - Intronic
1055350863 9:75386487-75386509 TCTCCTTGGTTATTATTTGCAGG - Intergenic
1055842758 9:80525867-80525889 TTTTCTTGATGATGATTTGAAGG - Intergenic
1056128252 9:83558133-83558155 TCACCTTGCAGATTTGTTGAAGG + Intergenic
1058886586 9:109326262-109326284 TCACTTTGTTTATTATTTAAAGG + Intergenic
1058922953 9:109634996-109635018 ACTACTTGATAATTATTTGAAGG + Intergenic
1061598928 9:131652974-131652996 TCAGCTTTATGATTATCTTATGG + Intronic
1202788738 9_KI270719v1_random:62657-62679 TGACATTGATGGTTATCTGATGG - Intergenic
1203739335 Un_GL000216v2:165051-165073 TCACCTGGGTGATTATTGCATGG - Intergenic
1186722968 X:12325830-12325852 TCACCTTGAAGAGTAGTTTAGGG - Intronic
1187505884 X:19878133-19878155 TCAACTTGATCATTATCTTATGG - Intronic
1188910896 X:35846187-35846209 TCACCATCATAATTGTTTGAAGG + Intergenic
1194639822 X:96390600-96390622 TAACCTTGATGATTATATAGAGG + Intergenic
1194927092 X:99837935-99837957 TGAGCCTTATGATTATTTGAAGG + Intergenic
1196090281 X:111733524-111733546 TCCACTTGATGATTAATTGATGG + Intronic
1196592852 X:117508035-117508057 TTACCTTGATTTTTATTGGATGG + Intergenic
1196689175 X:118541099-118541121 TCACCTCTCTGACTATTTGAGGG - Intronic
1197451405 X:126623137-126623159 TCACCTACATGAATATGTGATGG - Intergenic
1198362776 X:135912396-135912418 TCACCTTGCTGCTTCCTTGATGG - Exonic
1199162221 X:144627368-144627390 TCAACTTGGTGATTTTTTTAGGG - Intergenic
1200137977 X:153884095-153884117 TTTTCTTGATGATTATCTGAAGG - Intronic
1201125639 Y:10911545-10911567 TCACCTGGGTGATTATTGCAGGG + Intergenic
1202252944 Y:22891815-22891837 TCACCTGGATGCTAATTTCACGG + Intergenic
1202405934 Y:24525564-24525586 TCACCTGGATGCTAATTTCACGG + Intergenic
1202464846 Y:25144518-25144540 TCACCTGGATGCTAATTTCACGG - Intergenic
1202624668 Y:56845224-56845246 TCACCTGGATGATCATTGCAGGG - Intergenic