ID: 1103262841

View in Genome Browser
Species Human (GRCh38)
Location 12:119603484-119603506
Sequence TCACCTTGATGATTATTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103262841_1103262847 19 Left 1103262841 12:119603484-119603506 CCTTCAAATAATCATCAAGGTGA 0: 1
1: 0
2: 0
3: 13
4: 188
Right 1103262847 12:119603526-119603548 CCTAGAACTTTAATCACCTAAGG 0: 1
1: 0
2: 0
3: 9
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103262841 Original CRISPR TCACCTTGATGATTATTTGA AGG (reversed) Intronic