ID: 1103262841 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:119603484-119603506 |
Sequence | TCACCTTGATGATTATTTGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 202 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 13, 4: 188} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1103262841_1103262847 | 19 | Left | 1103262841 | 12:119603484-119603506 | CCTTCAAATAATCATCAAGGTGA | 0: 1 1: 0 2: 0 3: 13 4: 188 |
||
Right | 1103262847 | 12:119603526-119603548 | CCTAGAACTTTAATCACCTAAGG | 0: 1 1: 0 2: 0 3: 9 4: 80 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1103262841 | Original CRISPR | TCACCTTGATGATTATTTGA AGG (reversed) | Intronic | ||