ID: 1103269931

View in Genome Browser
Species Human (GRCh38)
Location 12:119664861-119664883
Sequence TGCCATGACCATGATGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103269929_1103269931 -2 Left 1103269929 12:119664840-119664862 CCAAAGGTCTTTTTGATGAGGTG 0: 1
1: 0
2: 1
3: 8
4: 124
Right 1103269931 12:119664861-119664883 TGCCATGACCATGATGTAGTGGG 0: 1
1: 0
2: 1
3: 12
4: 94
1103269927_1103269931 10 Left 1103269927 12:119664828-119664850 CCAGCTGGGGAACCAAAGGTCTT 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1103269931 12:119664861-119664883 TGCCATGACCATGATGTAGTGGG 0: 1
1: 0
2: 1
3: 12
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103269931 Original CRISPR TGCCATGACCATGATGTAGT GGG Intergenic
901020780 1:6254253-6254275 TGCCATGACTATGATATACTGGG - Intronic
907245497 1:53105909-53105931 TGGAGTGTCCATGATGTAGTGGG - Intronic
908580055 1:65505587-65505609 TGCCAGAACCATGATGAAGAAGG - Intronic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
913311838 1:117505903-117505925 TACCATTACCATTATGTATTAGG - Intronic
913649363 1:120896963-120896985 AGCCATCACGATGATGTATTTGG - Intergenic
914077329 1:144366542-144366564 AGCCATCACGATGATGTATTTGG + Intergenic
914101849 1:144599963-144599985 AGCCATCACGATGATGTATTTGG - Intergenic
914171780 1:145232126-145232148 AGCCATCACGATGATGTATTTGG + Intergenic
914297112 1:146337549-146337571 AGCCATCACGATGATGTATTTGG + Intergenic
914639515 1:149591048-149591070 AGCCATCACGATGATGTATTTGG - Intergenic
915058864 1:153162754-153162776 TGCAATGATAAAGATGTAGTTGG - Intergenic
919516214 1:198527591-198527613 TGTCATAACCATGATCTATTAGG - Intronic
919983472 1:202657173-202657195 TGTCATGACCATGATGAGGTTGG - Intronic
922540237 1:226413752-226413774 AGCCATGACCAGGATGAATTTGG - Intergenic
1066763320 10:38779230-38779252 TGCCAATACCATGATGTTTTGGG - Intergenic
1066958489 10:42196415-42196437 TGCCAATACCATGATGTTTTGGG + Intergenic
1068801217 10:61142359-61142381 TGCCATCACAAGGATGTAATAGG - Intergenic
1069946633 10:71990869-71990891 TCCCATGAACATTATGTATTAGG + Intronic
1071212319 10:83357872-83357894 TACCATGGGTATGATGTAGTAGG - Intergenic
1074828442 10:117231565-117231587 TGCCATGTCCATGTTCCAGTAGG - Intergenic
1076030543 10:127154016-127154038 TTCCATGACCATGATGAGCTTGG - Intronic
1076605379 10:131685893-131685915 TGCCGTGTCCATGATGTGCTTGG + Intergenic
1083626931 11:64076741-64076763 TGCGATGAGCATGTTGTTGTTGG + Intronic
1085160149 11:74334017-74334039 TAACATGAACTTGATGTAGTAGG - Exonic
1086815857 11:91369706-91369728 TACAATCACCATGATGTAATTGG - Intergenic
1088027504 11:105203981-105204003 TGCCATGGCAATGATGAAATTGG - Intergenic
1090601007 11:128371255-128371277 TGACATGAGCGTTATGTAGTTGG - Intergenic
1093932402 12:24967278-24967300 TCCCATGACCATGATGGAGTTGG + Intergenic
1095459473 12:42427388-42427410 TGCCAGTACCATGATGTTTTTGG - Intronic
1096949005 12:55444788-55444810 TTTCATGACCCTGAAGTAGTTGG + Intergenic
1097224965 12:57471648-57471670 TGCCATGAAAATTTTGTAGTGGG + Exonic
1098038385 12:66329674-66329696 TGCCATGAGGATGATGGATTGGG + Intronic
1099228321 12:79994577-79994599 AGCCACTACCATGGTGTAGTGGG + Intergenic
1099848742 12:88063856-88063878 TACCATCACCATGATATATTAGG + Intronic
1100353375 12:93806125-93806147 TACCATGAGCCTGGTGTAGTTGG + Intronic
1101661677 12:106771588-106771610 TGCCATGACAATGGGCTAGTTGG - Intronic
1103269931 12:119664861-119664883 TGCCATGACCATGATGTAGTGGG + Intergenic
1103681726 12:122699627-122699649 TGTCATGACTATGGTGGAGTGGG - Intergenic
1103683478 12:122713091-122713113 TGTCATGACTATGGTGGAGTGGG - Intergenic
1107230783 13:38107571-38107593 TGCTATTTCCATGATGAAGTAGG + Intergenic
1108537660 13:51402437-51402459 TCCCATAACCATGATATTGTGGG + Intronic
1110923585 13:81120715-81120737 TGCCATGACCATAGCGCAGTTGG + Intergenic
1113756459 13:112814984-112815006 TGCTGTGACCATCGTGTAGTGGG + Intronic
1128455955 15:67831541-67831563 TGCCCTGACCATGAGGTCATTGG - Intronic
1135848807 16:25943703-25943725 TACCATGATTATGTTGTAGTTGG - Intronic
1136778233 16:32882716-32882738 GGCCAGCACCATGATGTAGTAGG + Intergenic
1136892387 16:33978798-33978820 GGCCAGCACCATGATGTAGTAGG - Intergenic
1137615490 16:49843926-49843948 AGCCATGGCAATGATGTAGCAGG + Intronic
1203080655 16_KI270728v1_random:1144825-1144847 GGCCAGCACCATGATGTAGTAGG + Intergenic
1144409113 17:14982874-14982896 AGCCAGAATCATGATGTAGTGGG - Intergenic
1144495927 17:15744771-15744793 TCCCATGACTATGCTGTGGTTGG - Intronic
1144631979 17:16878450-16878472 TCCCATGACTGTGCTGTAGTTGG + Intergenic
1147773645 17:42885061-42885083 TCCCATCACCATGATGTGGTGGG - Intergenic
1155754077 18:29468217-29468239 TGCCATGACATTGATGGAGCCGG - Intergenic
1157033036 18:43936946-43936968 TCCCATGACCAAGATGTGCTCGG + Intergenic
1157634474 18:49137199-49137221 TGGCACCACCATGATGAAGTAGG - Intronic
1159533824 18:69690083-69690105 TGCCATGAACATGCTTTACTTGG + Intronic
1162421373 19:10567863-10567885 TGACATCACCATTATGTAGGAGG - Intronic
1163847506 19:19645907-19645929 GGCCATGGCCATGATGTAGACGG + Exonic
925645639 2:6033326-6033348 TGCCATGACCAAGAAGTAACAGG - Intergenic
926579151 2:14615772-14615794 TGCAATGACCATCATGTGTTAGG + Intergenic
926834449 2:17002406-17002428 TTTAATGACCATGATGTATTGGG + Intergenic
927638117 2:24830724-24830746 TGCCATCACCAGGATGAAGATGG + Exonic
929227410 2:39525013-39525035 TGCCAGGCCCATGATGACGTAGG - Intergenic
934761747 2:96860541-96860563 TGCCATGTCCCTGAGGTAGCTGG + Exonic
935757852 2:106290764-106290786 TGCCATGACCGTGCTGCAGTTGG + Intergenic
936110908 2:109663937-109663959 AGCCATGACTGTGCTGTAGTTGG - Intergenic
938295424 2:130175453-130175475 TGCCATAGCCGTGATGTTGTTGG - Intronic
938461197 2:131498375-131498397 TGCCATAGCCGTGATGTTGTTGG + Intergenic
939600794 2:144187742-144187764 TGGGATGATGATGATGTAGTGGG + Intronic
943028669 2:182660016-182660038 AGCCATGCCCATGATATATTTGG - Intergenic
1168818918 20:760600-760622 TGCCATGCCTGTGAGGTAGTTGG + Exonic
1182114598 22:27748756-27748778 TGCCAGGACCATGAGCTAATTGG + Exonic
950007702 3:9702086-9702108 TGCCATGTTCATGATGGAGATGG - Exonic
953145195 3:40268507-40268529 TGCCATAACCATGAAGCATTAGG + Intergenic
953835887 3:46343692-46343714 TGCCATGATAATGATGAATTTGG - Intergenic
958934455 3:100241637-100241659 TGCCATTTCCATGATGTAAGAGG - Intergenic
967504900 3:190243074-190243096 TGCCACAACCTGGATGTAGTTGG + Intergenic
972442707 4:39111221-39111243 TGCCATGATTATCATGTACTAGG + Intronic
977290200 4:95157781-95157803 TGCTATGACCATTATGTATGAGG + Exonic
982711287 4:158760827-158760849 ATCCATGGTCATGATGTAGTAGG + Intergenic
984647071 4:182231707-182231729 TACCAAGAGCATGATGTTGTTGG - Intronic
991019809 5:61968673-61968695 TGGTATTACCATGATGTTGTTGG - Intergenic
993419575 5:87684034-87684056 TGCCAGGACCCTGATGAAGTTGG - Intergenic
996649955 5:125863763-125863785 TGCCGTAACCATAGTGTAGTAGG + Intergenic
999175293 5:149627706-149627728 GGCCATGACCAGTATGGAGTGGG - Intronic
1001280849 5:170385337-170385359 AGTCGTGACCAGGATGTAGTAGG + Exonic
1002338089 5:178494356-178494378 TGCCATGAACGTGATGTGTTGGG + Intronic
1014391540 6:120871863-120871885 TGCAAAGACCAGGATGCAGTGGG + Intergenic
1018562454 6:165116552-165116574 TGCTATGACCATGATTTTATAGG - Intergenic
1020650129 7:10864948-10864970 TGAAATGACCATGAGGTGGTAGG + Intergenic
1027517913 7:79165587-79165609 TGCCATGACCAAAATTTAGAAGG + Intronic
1043487941 8:80717165-80717187 TGCAATGACCATGAAGTGATGGG - Intronic
1046772545 8:118130629-118130651 TGCAATGACCATGACTTAGACGG + Intergenic
1048600731 8:135916334-135916356 TGCCATGGCCATCATGAAGCAGG + Intergenic
1050012512 9:1199622-1199644 TGCCCTGAGCATGGTGTAGGTGG + Intergenic
1051538401 9:18186469-18186491 TGACATGACTAGGATGTATTTGG - Intergenic
1058728039 9:107822232-107822254 AGCCTTGACCATGGTGTATTTGG + Intergenic
1059947057 9:119420240-119420262 TGCCCTGACCATTATGCAGAAGG + Intergenic
1062468581 9:136692224-136692246 CGCCCTGCCCATGATGTGGTCGG + Intergenic
1185536661 X:868054-868076 TGCCATGCCCAAGATGTAGACGG - Intergenic
1190642588 X:52495199-52495221 TGCCATGGCCTTGCTGTTGTGGG + Intergenic
1190645085 X:52517668-52517690 TGCCATGGCCTTGCTGTTGTGGG - Intronic
1191084191 X:56546855-56546877 TGCCAGGGGCATGATGCAGTGGG - Intergenic
1192852241 X:74969333-74969355 TGCCATGCCCAGGATGTAATAGG - Intergenic
1196170608 X:112584239-112584261 TCACATCACCATGATATAGTGGG + Intergenic
1200101602 X:153691346-153691368 GGCCAGCACCATGATGTAGTAGG - Exonic