ID: 1103272071

View in Genome Browser
Species Human (GRCh38)
Location 12:119681708-119681730
Sequence CTTGTGGCTCTGAGCGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103272065_1103272071 27 Left 1103272065 12:119681658-119681680 CCCTTGGAGAAGAGACTGGAACT 0: 1
1: 0
2: 2
3: 21
4: 227
Right 1103272071 12:119681708-119681730 CTTGTGGCTCTGAGCGGACAGGG 0: 1
1: 0
2: 1
3: 6
4: 118
1103272066_1103272071 26 Left 1103272066 12:119681659-119681681 CCTTGGAGAAGAGACTGGAACTC 0: 1
1: 0
2: 0
3: 33
4: 298
Right 1103272071 12:119681708-119681730 CTTGTGGCTCTGAGCGGACAGGG 0: 1
1: 0
2: 1
3: 6
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103272071 Original CRISPR CTTGTGGCTCTGAGCGGACA GGG Intergenic
900513620 1:3071297-3071319 CTTCTGGTCCTGAGCGGACCCGG - Intronic
901220991 1:7583711-7583733 CTTGTGGATCAGAGTGGACTTGG - Intronic
904453282 1:30630604-30630626 GTTGTGGCTCTGTGGGGATAAGG - Intergenic
907771410 1:57468559-57468581 CTGGTGGCTCTGAACAGACAGGG + Intronic
912586366 1:110770531-110770553 ATTGTGTGTCTGAGCAGACAGGG + Intergenic
912771138 1:112465127-112465149 TTTGTGCCTCTGAGCAGACAGGG + Intergenic
917092672 1:171369491-171369513 CTTTTGTCTCTCAGAGGACATGG - Intergenic
919310109 1:195896219-195896241 TTTGTGAATCTGAGTGGACAAGG - Intergenic
920651211 1:207838715-207838737 CTTGTGGCGCTGAGCTGAGGAGG + Intergenic
1068280004 10:54855323-54855345 CTCTTGGCTCTGAGAGCACAGGG + Intronic
1080569905 11:33546372-33546394 CTTCTGCCTCTGAGGGGCCAGGG - Intronic
1081703813 11:45168631-45168653 CCTGTGGCTCTTAGTGGGCAGGG - Intronic
1083246890 11:61435762-61435784 CTTGGGGCACTGATGGGACATGG - Intronic
1087659810 11:100974048-100974070 CTGTTGGCTCTGAGCTGCCAAGG - Intronic
1089256873 11:117198895-117198917 CTTTTAGCTCTGATGGGACATGG - Intergenic
1091057388 11:132431510-132431532 CTTGTGGCTCTGTGTGGGGAAGG + Intronic
1094331345 12:29297615-29297637 CTTGGGGCTCAGAGAGGGCAAGG - Intronic
1103272071 12:119681708-119681730 CTTGTGGCTCTGAGCGGACAGGG + Intergenic
1104109104 12:125688975-125688997 ATTGTGACTGTGAGTGGACATGG + Intergenic
1104877234 12:132044077-132044099 CATGTGGCTCTGAGACAACAGGG + Intronic
1106435954 13:29722815-29722837 CCTGTGACTCTGAGCGGACAAGG - Intergenic
1108450392 13:50556766-50556788 CATGAGGCTCTGAGTGGCCAGGG - Intronic
1113745312 13:112740643-112740665 TTTGTAGCTCTCAGCAGACAAGG + Intronic
1114539251 14:23442774-23442796 CTTGTGGCTCTGAGAAGCCAGGG + Intergenic
1122131916 14:99609242-99609264 ACTGGGGCTCTGAGAGGACAAGG - Intergenic
1129669752 15:77600846-77600868 CTTGTTGCTATGCGTGGACAAGG - Intergenic
1135251641 16:20905375-20905397 TTTTGGGCTCTGGGCGGACAAGG - Intronic
1136348438 16:29691857-29691879 CTTGTGGCTCGGAGGGGAGGTGG + Intronic
1138721536 16:59087827-59087849 CTTGTCACTCTGAGGGGAAAGGG + Intergenic
1140812905 16:78595372-78595394 CTTGTGGCTGTCAGCGGGGAGGG - Intronic
1142388091 16:89779692-89779714 CATGTGGCTCTGGGCAGAAATGG + Intronic
1145273779 17:21418285-21418307 CTTCTGGCTCTGAGCTGTCTCGG - Exonic
1145273784 17:21418313-21418335 CTTCTGGCTCTGAGCTGTCTCGG - Exonic
1145273789 17:21418341-21418363 CTTCTGGCTCTGAGCTGTCTCGG - Exonic
1147896681 17:43755945-43755967 CATTTGGCTCCGAGGGGACAGGG - Intronic
1150008312 17:61483248-61483270 CTGGGAGCTCTGAGCGGAGAGGG - Exonic
1151216957 17:72583584-72583606 TTGGTGGCTCTGAGGTGACAAGG + Intergenic
1152292077 17:79445716-79445738 CTTGTGACTCTGGGAGCACATGG - Intronic
1155254088 18:23979527-23979549 CTTCTTGCTCTGTGCTGACAGGG + Intergenic
1160187625 18:76687885-76687907 ATTGTATCTCTGAGCAGACATGG - Intergenic
1168318113 19:55493095-55493117 CTAGTGGCTCTCAGCTGGCAAGG + Intronic
926765145 2:16317715-16317737 CTTGAATCTCTGAGTGGACAGGG - Intergenic
927048093 2:19300218-19300240 CTTGTGGCACTAAGAGGAAAAGG - Intergenic
932016609 2:68034545-68034567 CTTGTGGCTGTGTGGGGACTGGG + Intergenic
932617617 2:73244573-73244595 CTTGGAGCTCAGAGCGGTCATGG - Exonic
938367626 2:130747413-130747435 CTTTTGGCTGTGTGAGGACACGG - Intergenic
938557016 2:132434482-132434504 CATGGGGCTCTGAGTGGCCAAGG - Intronic
946428554 2:219612922-219612944 GCTGAGGCTCTGAGCGGGCAGGG + Intronic
947548316 2:231028115-231028137 GTTGTGGCTCTGATCTAACAAGG + Intergenic
1171750111 20:29040328-29040350 TGTGTGGGTCTGAGCGGACTAGG + Intergenic
1172643446 20:36455507-36455529 CTTGTGGCTCTAGGCTGACCTGG + Intronic
1172857498 20:38017137-38017159 CTAGAGGCTCTGAGAGGGCAGGG + Intronic
1175224769 20:57438792-57438814 CTTGTTTCTCTGTGCAGACAAGG - Intergenic
1176315107 21:5235584-5235606 TGTGTGGGTCTGAGCGGACTAGG - Intergenic
1176388940 21:6153773-6153795 CTTGTGGTGCTGAGTGGCCATGG - Intergenic
1178003679 21:28192797-28192819 CTAGTGGCTGGGAGCAGACATGG + Intergenic
1178470275 21:32886228-32886250 CTTGTGCATCTGTGCGGACTTGG - Intergenic
1179524377 21:41966103-41966125 CTCAGGGCTCTGAGAGGACATGG + Intergenic
1179734532 21:43384475-43384497 CTTGTGGTGCTGAGTGGCCATGG + Intergenic
1180067735 21:45421020-45421042 CTCCTGGCTCGGAGCAGACACGG - Intronic
1180392894 22:12301541-12301563 TGTGTGGGTCTGAGCGGACTAGG - Intergenic
1180406857 22:12563227-12563249 TGTGTGGGTCTGAGCGGACTAGG + Intergenic
1180902644 22:19385824-19385846 CTCCTGGCTCTGAGTGGAGAAGG + Intronic
1182743706 22:32588258-32588280 CTTGCGGCCCAGAGAGGACAAGG - Intronic
1184594188 22:45503993-45504015 CTAGTGGCTCTGAGAAGCCACGG - Intronic
1184808521 22:46812377-46812399 CTTGTGGTGCTGAGGAGACACGG + Intronic
1185136656 22:49077297-49077319 CTTATGGCCATGAGGGGACAGGG - Intergenic
949791908 3:7801919-7801941 ATGGTGCCTGTGAGCGGACAGGG - Intergenic
953069152 3:39502549-39502571 CTTGGGCCTCTGAGGGGACTTGG - Exonic
953504688 3:43473474-43473496 CGTGTGGCACTGAGAGCACAGGG - Intronic
954669743 3:52283580-52283602 CTTCTGGCTCTGAGCAGTCAAGG - Intronic
954798666 3:53174613-53174635 CTTGTGGCTCAGAGAGGCCCAGG + Intronic
955207725 3:56911544-56911566 CGTGTGACTCGGAGCGGGCAAGG - Intronic
955536783 3:59932053-59932075 CTTTTGGCTTTGAGCTCACAAGG + Intronic
955899886 3:63741256-63741278 CTGGTGTCTCTGAGCTGAAAAGG + Intergenic
956089145 3:65645689-65645711 CATGTGGCTCTAAGAGTACATGG + Intronic
965606732 3:170504914-170504936 CTTGTGGCATTAAGTGGACAGGG + Intronic
965821964 3:172693340-172693362 CTTGTGGCTTTGTGTGCACACGG - Intronic
968830071 4:2928718-2928740 GCTGAGGCTCTGAGAGGACAAGG - Exonic
969095310 4:4728525-4728547 CCTGTGGCTCTGAGCTGGCATGG + Intergenic
969449021 4:7262497-7262519 CTGGAAGCTCTGAGAGGACAGGG - Intronic
969868145 4:10088591-10088613 CCTGCGGCTCTGAGCAGTCACGG + Intronic
974771746 4:66423481-66423503 CTTGTAGCTCTGGGAGGAAAGGG + Intergenic
976180371 4:82393206-82393228 CTTGTAGCTCTGTGAGGAGATGG + Intergenic
978129559 4:105178651-105178673 GTTGTGGGTCTGTGGGGACAGGG + Intronic
985432026 4:189889980-189890002 TGTGTGGGTCTGAGCGGACTAGG + Intergenic
985721186 5:1490062-1490084 CTTGTGGCACTGAGGCTACAGGG - Intronic
985868928 5:2538520-2538542 CTTGTGGCAAGAAGCGGACAGGG + Intergenic
986636472 5:9827091-9827113 GTTGTGTCTGTGAGCGGAAAAGG - Intergenic
988452791 5:31360041-31360063 CTCCTGCCTCTGAGAGGACATGG + Intergenic
990282908 5:54270859-54270881 CATGTGAGTCTGAGCGGACTAGG + Intronic
992421858 5:76614078-76614100 CATGTGGCTGTGGGCAGACAGGG - Intronic
994451485 5:99950227-99950249 CCTGAGGCTCTGAGAGTACAAGG - Intergenic
997450834 5:133981875-133981897 CTTGAGGCTCTGAGTGGATCTGG - Intronic
999267820 5:150278477-150278499 CTTGTGGCCCTGAGCTGAGCAGG + Intronic
1005081810 6:21964102-21964124 CTTCTGGGGCTGGGCGGACAGGG + Intergenic
1016414609 6:143819780-143819802 CTTGTGAGTCTGAGTGGACTAGG - Intronic
1016939224 6:149470860-149470882 CAAGTGGCTCTGTGGGGACAGGG + Intronic
1017642175 6:156505048-156505070 CATGTGGCTCTGAGTTGCCATGG + Intergenic
1018176710 6:161183835-161183857 CTCGTGGCTCTCTGGGGACATGG + Intronic
1019121019 6:169803467-169803489 CATAGAGCTCTGAGCGGACACGG + Intergenic
1019789818 7:3003968-3003990 CTTCTGGCGCTGATCGGACGTGG - Intronic
1030200209 7:106895437-106895459 CTTCTGGGACTGAGCGGGCAGGG + Intronic
1030231513 7:107212862-107212884 CCTGTGGCTCTGTGCTGACTTGG - Intronic
1034731758 7:153393003-153393025 CTGATGGCTCTGAGCTGAAAGGG + Intergenic
1035087967 7:156277751-156277773 CATGTGTGTCTGAGTGGACAGGG + Intergenic
1035199146 7:157248930-157248952 GAGGTGGCTCTGAGCGGGCAAGG - Intronic
1037468369 8:19183340-19183362 CTTGGGGCTGTGAGTGGAGAAGG + Intergenic
1041694851 8:60725132-60725154 CCTGTGGCTCTGAGAGGCCCTGG - Intronic
1049410359 8:142471269-142471291 GTTCTGGCTCTGAGCGGAGGAGG - Intronic
1054344800 9:63904132-63904154 TGTGTGGGTCTGAGCGGACTAGG - Intergenic
1056544338 9:87601352-87601374 CTTGTGACTCTGAGCTCCCAAGG + Intronic
1057820046 9:98323395-98323417 ATTGTGGCCCTGAGCTGGCAAGG + Intronic
1057909207 9:99005013-99005035 CCCGAGGCTCTGGGCGGACATGG - Exonic
1060026533 9:120176683-120176705 TTTGGGGCTCTGAGCTGACCTGG + Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1186596917 X:10992054-10992076 CCTGTGGCACTGAGATGACAAGG - Intergenic
1188780291 X:34275230-34275252 CTTGTGGCTCTGTCAAGACAAGG - Intergenic
1190394222 X:49963526-49963548 CTTCTTGCTCTGAGTGGTCAAGG - Intronic
1192962105 X:76142292-76142314 CTGTTGGCTCTTACCGGACAAGG + Intergenic
1192963428 X:76152795-76152817 CTGTTGGCTCTTACCGGACAAGG - Intergenic
1195709261 X:107760911-107760933 CATCTGGCTCTGAGCAGAAAAGG + Intronic
1196283840 X:113856783-113856805 CATGTGACTCTGAGTGGACTAGG + Intergenic
1198957465 X:142148497-142148519 CTTGTAGTTCTCAACGGACATGG - Intergenic
1199553209 X:149079252-149079274 TTTATGGGTCTGAGGGGACACGG + Intergenic
1200425763 Y:3019039-3019061 CTTTTGTCTCTGAGCTGACAAGG + Intergenic