ID: 1103272882

View in Genome Browser
Species Human (GRCh38)
Location 12:119688130-119688152
Sequence GGCTGAGCACGTGGGCGCTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 107}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103272870_1103272882 17 Left 1103272870 12:119688090-119688112 CCGTGCCGAGGTGGGTCTGGGCC 0: 1
1: 0
2: 0
3: 13
4: 169
Right 1103272882 12:119688130-119688152 GGCTGAGCACGTGGGCGCTTGGG 0: 1
1: 0
2: 1
3: 10
4: 107
1103272876_1103272882 -5 Left 1103272876 12:119688112-119688134 CCCGCTGAGCCAGAGGGTGGCTG 0: 1
1: 0
2: 2
3: 22
4: 215
Right 1103272882 12:119688130-119688152 GGCTGAGCACGTGGGCGCTTGGG 0: 1
1: 0
2: 1
3: 10
4: 107
1103272877_1103272882 -6 Left 1103272877 12:119688113-119688135 CCGCTGAGCCAGAGGGTGGCTGA 0: 1
1: 0
2: 1
3: 22
4: 219
Right 1103272882 12:119688130-119688152 GGCTGAGCACGTGGGCGCTTGGG 0: 1
1: 0
2: 1
3: 10
4: 107
1103272875_1103272882 -4 Left 1103272875 12:119688111-119688133 CCCCGCTGAGCCAGAGGGTGGCT 0: 1
1: 0
2: 1
3: 9
4: 172
Right 1103272882 12:119688130-119688152 GGCTGAGCACGTGGGCGCTTGGG 0: 1
1: 0
2: 1
3: 10
4: 107
1103272871_1103272882 12 Left 1103272871 12:119688095-119688117 CCGAGGTGGGTCTGGGCCCCGCT 0: 1
1: 0
2: 2
3: 12
4: 191
Right 1103272882 12:119688130-119688152 GGCTGAGCACGTGGGCGCTTGGG 0: 1
1: 0
2: 1
3: 10
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103272882 Original CRISPR GGCTGAGCACGTGGGCGCTT GGG Exonic