ID: 1103277621

View in Genome Browser
Species Human (GRCh38)
Location 12:119725959-119725981
Sequence GTGTTGTTCTTAAGGCCACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103277614_1103277621 24 Left 1103277614 12:119725912-119725934 CCTAATTCTCTATTTGACCACGA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1103277621 12:119725959-119725981 GTGTTGTTCTTAAGGCCACGGGG 0: 1
1: 0
2: 0
3: 5
4: 114
1103277616_1103277621 7 Left 1103277616 12:119725929-119725951 CCACGAGGTACATTTAACATTTC 0: 1
1: 0
2: 1
3: 8
4: 89
Right 1103277621 12:119725959-119725981 GTGTTGTTCTTAAGGCCACGGGG 0: 1
1: 0
2: 0
3: 5
4: 114
1103277613_1103277621 25 Left 1103277613 12:119725911-119725933 CCCTAATTCTCTATTTGACCACG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1103277621 12:119725959-119725981 GTGTTGTTCTTAAGGCCACGGGG 0: 1
1: 0
2: 0
3: 5
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103277621 Original CRISPR GTGTTGTTCTTAAGGCCACG GGG Intronic
904423510 1:30409111-30409133 GAGTTGCTCTTATGGCCACAGGG + Intergenic
907682012 1:56573241-56573263 GTGTTGTTTCTAATGCCAAGAGG - Intronic
909546375 1:76853006-76853028 TTCTTGTTCTTTATGCCACGAGG - Intergenic
915053769 1:153105714-153105736 ATATTGTTCTTATTGCCACGTGG + Intronic
915274225 1:154776888-154776910 GTGTTCTTCTTAAGGCTCCCAGG + Intronic
915970706 1:160353156-160353178 ATGAAGTTCTTAAGGCCACCTGG - Exonic
919648677 1:200123609-200123631 GCAGTGTTCTTAAGGCGACGGGG + Intronic
919894367 1:201999794-201999816 CTGTTCTTCTTGAGGCCACAAGG + Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922457969 1:225791957-225791979 TTGGTGTTCCAAAGGCCACGAGG + Intergenic
922459140 1:225801281-225801303 TTGGTGTTCCAAAGGCCACGAGG + Intergenic
1067166871 10:43872307-43872329 GTGTTCTTCTTAAGTCTACCTGG - Intergenic
1074300265 10:112226939-112226961 TTGGTGTTCCAAAGGCCACGAGG + Intergenic
1076074006 10:127517851-127517873 GTCATTTTCTTAAGGCCACAGGG - Intergenic
1076370618 10:129950393-129950415 GTGTTGTTTTTAAGGGGAAGGGG + Intronic
1076444969 10:130508017-130508039 GTGTTGTTCTTCAGGTCCCAGGG + Intergenic
1076487992 10:130836465-130836487 CTTTTCTTCTTATGGCCACGTGG + Intergenic
1078683496 11:13503738-13503760 GTGTTGTTCTTACATCCACTTGG + Intergenic
1085118010 11:73947363-73947385 TTGGTGTTCCAAAGGCCACGAGG + Intergenic
1085645861 11:78222162-78222184 GTGTTGTTCCTCAGGTCAAGTGG + Exonic
1089826275 11:121281061-121281083 CTGATGTTCCAAAGGCCACGAGG - Intergenic
1091146049 11:133281306-133281328 GTGCTGTTCTTAAGGTAATGTGG + Intronic
1095699454 12:45175944-45175966 TTGGTGTTCCAAAGGCCACGAGG - Intergenic
1095741843 12:45616025-45616047 GTGTTGTTATCAAGGCTATGTGG + Intergenic
1098914207 12:76240433-76240455 TTGGTGTTCCAAAGGCCACGAGG - Intergenic
1100858796 12:98782951-98782973 GTGTTGATTTTAAGGCAACGCGG + Intronic
1103277621 12:119725959-119725981 GTGTTGTTCTTAAGGCCACGGGG + Intronic
1103615152 12:122147146-122147168 GGTTTGTTCTTCAGACCACGAGG - Exonic
1104184695 12:126419255-126419277 TTGTTGTTCTGAAGACCAAGAGG + Intergenic
1108199852 13:48032313-48032335 TTGGTGTTCTAAAGGCCACGAGG + Intergenic
1110820580 13:79910596-79910618 CTGTTGTTCTTAAAGCCCCAGGG - Intergenic
1112001735 13:95217030-95217052 GTATTGTTCTTAATGGCATGCGG - Intronic
1114518609 14:23318718-23318740 GTGAGATTCTTAAGGCCAGGCGG - Intronic
1122642744 14:103170089-103170111 TTGGTGTTCCAAAGGCCACGAGG - Intergenic
1123951050 15:25275571-25275593 GTGTTGTTCTTAAGTGCCCATGG - Intergenic
1127498030 15:59530762-59530784 GTGTTGTCCTTTCAGCCACGTGG + Intergenic
1128530459 15:68441679-68441701 GTGTTGGGCTTAAGGCCTCTTGG + Intergenic
1129106469 15:73311630-73311652 GTATTCTTCTCAAGGGCACGTGG - Intergenic
1130584606 15:85171531-85171553 TTGGTGTTCCAAAGGCCACGAGG - Intergenic
1133465155 16:6020682-6020704 GTGTTGTTGTGCAGGCCAGGGGG + Intronic
1134276366 16:12780072-12780094 GTCCTGTTCTTTAGGGCACGTGG + Intronic
1135231899 16:20716357-20716379 TTGCTGTTCCAAAGGCCACGAGG - Intronic
1136272617 16:29157729-29157751 GTGTTGTTCATCAGTGCACGTGG - Intergenic
1142300170 16:89252969-89252991 CTGTTCTTCTTAAGCCCACCTGG - Intergenic
1143164150 17:4889612-4889634 GTATGGTTCTTAAGACCACCTGG + Intronic
1145041075 17:19579195-19579217 GCCTTGTTCTTGGGGCCACGAGG + Intergenic
1145184880 17:20785411-20785433 CTGTGGTGCTTAATGCCACGTGG + Intergenic
1149099971 17:52893898-52893920 GTGTTCTTCTTGAGGGCACTTGG + Intronic
1150640160 17:66944243-66944265 GTTTTGTTCTGAAGGCAGCGGGG - Intergenic
1153365497 18:4251125-4251147 GTATTTTTCTGAAGGCCAGGAGG - Intronic
1155391722 18:25345527-25345549 TTTTTGTTTTTAAGGCCAAGTGG + Intronic
1155796513 18:30044531-30044553 TTGGTGTTCCAAAGGCCACGAGG - Intergenic
1156003580 18:32413310-32413332 GTTTTGTTTTTAAGGCTAAGCGG - Intronic
1158478184 18:57798809-57798831 CTGTTGTTCTTAAGCCCTGGTGG - Intronic
1162693208 19:12450677-12450699 TTGGTGTTCCAAAGGCCACGAGG - Intronic
1163640275 19:18458099-18458121 GTGTGGTCCTGAAGGCCACAGGG - Intronic
929369865 2:41210073-41210095 TTGGTGTTCCAAAGGCCACGAGG - Intergenic
930198728 2:48532721-48532743 GGGTTGTAATGAAGGCCACGGGG + Intronic
931826972 2:66010711-66010733 GTGTAGTTTTTGAGGCCTCGTGG + Intergenic
935751833 2:106242123-106242145 TTGGTGTTCCAAAGGCCACGAGG + Intergenic
937370137 2:121291613-121291635 GTGATCCTCTGAAGGCCACGTGG - Intergenic
941570737 2:167166784-167166806 GTGTTGGTGTTGAGGCCTCGTGG - Intronic
942707519 2:178793304-178793326 GTGTTGTTCCTTGGGCCACATGG - Intronic
1170729786 20:18963521-18963543 GTGTTGTTATGAAGTCCATGGGG - Intergenic
1172046625 20:32085011-32085033 GTGTTGTTCTTAAGTTCTTGGGG - Intronic
1172597372 20:36158669-36158691 GTGATGTGCCCAAGGCCACGTGG - Intronic
1172858938 20:38032488-38032510 TTGTTTTTCTTACTGCCACGGGG - Intronic
1173420976 20:42900779-42900801 TTGGTGTTCCAAAGGCCACGAGG - Intronic
1175894035 20:62328188-62328210 ATGCTGTCCTTAAGGCCACCAGG + Intronic
1179350488 21:40606256-40606278 GTGTTGGTGTTGGGGCCACGAGG + Intronic
1179413260 21:41178292-41178314 GTATTGTTCCTAACACCACGTGG + Intronic
1180741228 22:18054401-18054423 GTGTGGTTCTTAAAGCCCTGGGG - Intergenic
1181045751 22:20213544-20213566 GTGTAGTTCTGAAGGCCCCTGGG + Intergenic
1182284907 22:29240434-29240456 TTGGTGTTCCAAAGGCCACGAGG - Intronic
1183869305 22:40729204-40729226 TTGGTGTTCCAAAGGCCACGAGG + Intergenic
953636983 3:44672095-44672117 GTGTGGTGGTTAAGGCCAGGTGG - Intergenic
958655367 3:96995125-96995147 GTGTTGTTATTAAGGCTTCATGG + Intronic
961817758 3:129560040-129560062 GTGATGTCCCCAAGGCCACGTGG - Intronic
965179899 3:165388743-165388765 TTGGTGTTCCAAAGGCCACGAGG + Intergenic
966988509 3:185204402-185204424 GTGTTGTTGGTAAGACCATGGGG - Exonic
967483921 3:190008143-190008165 GTGTTCTTCTCAGGGTCACGTGG + Intronic
967564079 3:190953156-190953178 TTGGTGTTCCAAAGGCCACGAGG + Intergenic
969037765 4:4269154-4269176 GTGTTGCTCTGCAGGCCCCGAGG - Intronic
969435624 4:7187663-7187685 GTGTGGTTCTTGAAGCCAAGAGG + Intergenic
974802315 4:66833558-66833580 CTGTTGTTTTTAAACCCACGTGG - Intergenic
988438788 5:31208339-31208361 TTGGTGTTCCAAAGGCCACGAGG + Intronic
989518816 5:42376780-42376802 CTGTTGTTTTTAAGACCACCTGG - Intergenic
992292282 5:75292031-75292053 TTGGTGTTCCAAAGGCCACGAGG + Intergenic
998309148 5:141109430-141109452 GTGCTGTTATTAAGGACAAGTGG + Intronic
999788221 5:154911565-154911587 GTGTTGTTCTCAAGCCCTTGTGG + Intronic
1005225007 6:23632430-23632452 GTGTTGATGTTAAGGCCACCTGG - Intergenic
1005451914 6:25982057-25982079 TTGGTGTTCCAAAGGCCACGAGG - Intronic
1006114626 6:31768902-31768924 GTGTTGTTCTTCCAGTCACGGGG - Intronic
1013151558 6:107451388-107451410 TTGGTGTTCCAAAGGCCACGAGG - Intronic
1014937050 6:127397364-127397386 TTGGTGTTCCAAAGGCCACGAGG - Intergenic
1016337162 6:143019140-143019162 GTGTTGTTTTGCAGACCACGTGG - Intergenic
1017303513 6:152889974-152889996 TTTTTGTTCTTATGGCCAAGAGG + Intergenic
1024499882 7:50093400-50093422 GTGTTGTCCTGAAGGCCCGGGGG - Intronic
1032556333 7:132839242-132839264 TTGTTGTTCTTGTGGTCACGTGG - Intronic
1039445749 8:37630529-37630551 GAGTTGTTCTTATGGCCAGGAGG + Intergenic
1041671202 8:60493551-60493573 TTGGTGTTCCAAAGGCCACGAGG - Intergenic
1041671801 8:60499407-60499429 TTGGTGTTCCAAAGGCCACGAGG - Intergenic
1042833244 8:73054391-73054413 GTTTTGTTTTTAAGGACACAGGG + Intergenic
1046467773 8:114628456-114628478 TTGGTGTTCCAAAGGCCACGAGG + Intergenic
1050444090 9:5699923-5699945 TTGTGGTTCTTAAAGCCAAGAGG - Intronic
1050766993 9:9146874-9146896 TTGTTGTTCTAAAGGCCACCTGG - Intronic
1057366440 9:94426010-94426032 GTGTAGTTCTTCAGCCCAGGTGG + Intronic
1057552120 9:96059102-96059124 GGGCTGTTCTTAAAACCACGAGG + Intergenic
1057656893 9:96962056-96962078 GTGTAGTTCTTCAGCCCAGGTGG - Intronic
1059020188 9:110568040-110568062 TTGTTGTTCTTAATTCCACTAGG - Intronic
1186316176 X:8373257-8373279 CTGGTGTTCCAAAGGCCACGAGG - Intergenic
1187090512 X:16091383-16091405 GTGTTTTTCATCAGGCCACATGG - Intergenic
1187683411 X:21792024-21792046 GTGCTGTTCTTCAGGCCCCAAGG - Intergenic
1189056291 X:37702362-37702384 GGGTTGTCCTTAGGGCCATGTGG - Intronic
1192545236 X:72007476-72007498 GAGTTCTTCTTAAGGGCACCAGG + Intergenic
1195405524 X:104508980-104509002 GTGATGTGCTTAAGGACACAGGG + Intergenic
1199344691 X:146724541-146724563 ATGTTGTTCTCAAGGCAAAGAGG - Intergenic
1200258453 X:154598659-154598681 TTGGTGTTCCAAAGGCCACGAGG + Intergenic
1200377913 X:155803696-155803718 TTGGTGTTCCAAAGGCCACGAGG + Intergenic
1200395831 X:155987122-155987144 TTGGTGTTCCAAAGGCCACGAGG + Intergenic