ID: 1103279029

View in Genome Browser
Species Human (GRCh38)
Location 12:119739242-119739264
Sequence CCTCTAAAACAGACTTAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103279029 Original CRISPR CCTCTAAAACAGACTTAGGT AGG Intronic
902208004 1:14883901-14883923 TCTGTAAAACAGACTGAGGCTGG - Intronic
903055700 1:20634552-20634574 ACCCTAATACAGACTTTGGTTGG - Intronic
904094767 1:27967977-27967999 CCTCTCACATAGACTGAGGTAGG - Exonic
905360631 1:37417392-37417414 ACTGTAAAACAGCCTTAGGCAGG + Intergenic
906552550 1:46677567-46677589 GCTTTAAGACAGACTTAAGTGGG + Exonic
907081978 1:51632064-51632086 ACTGTAAAACAGCCTCAGGTAGG - Intronic
907768456 1:57435746-57435768 CCTTTAAAACAGCCTTAGGCAGG - Intronic
908721423 1:67130250-67130272 CCAGTAAAATAAACTTAGGTGGG - Intronic
912909484 1:113743436-113743458 ACTGTAAAACAGTCTCAGGTAGG - Intronic
914910663 1:151783275-151783297 CTTTTAAAACTGACTTGGGTGGG - Intronic
915559922 1:156681205-156681227 TCTCTAATGCAGACTTCGGTGGG - Intergenic
917449953 1:175139592-175139614 CCTGTAAAACAGCCTCAGGCAGG - Intronic
918916396 1:190645386-190645408 ACTGTAAAACAGACTCAGGTAGG - Intergenic
920918088 1:210274489-210274511 ACTGTAAAACAGCCTTAGGGAGG - Intergenic
922373130 1:224930957-224930979 CCTGTAAAACAGCCTTAGGCTGG + Intronic
924893516 1:248310521-248310543 CTTTTAAACCATACTTAGGTTGG + Intergenic
1063286221 10:4691934-4691956 CCTTTAACACAGACATAGGCTGG - Intergenic
1065105644 10:22381200-22381222 CCTCTAAAACAGCCTGTGGGGGG - Intronic
1065977876 10:30859371-30859393 CTTGTAAAACAGACTTGGCTGGG - Intronic
1066310701 10:34192891-34192913 CCTCAAAAACAGACTTAGAGAGG - Intronic
1071031314 10:81185421-81185443 TCTCTAAAAGACACTTTGGTTGG + Intergenic
1071892138 10:90021395-90021417 ACTGTAAAACAGCCTCAGGTGGG - Intergenic
1077788352 11:5410625-5410647 ACTGTAAAAAAGACTCAGGTAGG + Intronic
1077871634 11:6267546-6267568 ACTATAAAACAGACTCAGGCAGG - Intronic
1079118917 11:17663418-17663440 ACTGTAAAACAGCCTTAGGCAGG - Intergenic
1079762227 11:24343366-24343388 CTTATAAAATAGTCTTAGGTAGG + Intergenic
1081585212 11:44379633-44379655 ACTCCCACACAGACTTAGGTTGG + Intergenic
1087091090 11:94273913-94273935 CTTTCAAAACAGACTTAGGCTGG + Intergenic
1087941622 11:104103907-104103929 ACTGTAAAACAGCCTTAGGCAGG + Intronic
1088086876 11:105991721-105991743 ACTGTAAAACAGCCTTAGGCAGG - Intergenic
1088097806 11:106120184-106120206 CCTTTAAAACTGACTTTGGCAGG - Intergenic
1093687060 12:22069020-22069042 CCTGTAGAACAGACATAAGTTGG + Intronic
1096543936 12:52324080-52324102 CCTTGAAAACAGACTTAGACAGG + Intergenic
1098515367 12:71369596-71369618 CCTGTAAAACAGCCTCAGGCAGG + Intronic
1098555457 12:71813722-71813744 CCTCTTAAACAGACAGAGGTAGG - Intergenic
1100587995 12:95997241-95997263 CCACTAAATCAGACTTCTGTTGG + Intergenic
1103229600 12:119317835-119317857 CCTGTAAAACAGCCTCAGGCAGG - Intergenic
1103279029 12:119739242-119739264 CCTCTAAAACAGACTTAGGTAGG + Intronic
1104105491 12:125654896-125654918 CCTCTAAAACAGCCACATGTGGG + Exonic
1108984874 13:56574231-56574253 TCTTTAAAACAGACTTGGCTAGG - Intergenic
1109587446 13:64425346-64425368 ACTGTAAAGCAGTCTTAGGTAGG - Intergenic
1110232944 13:73185525-73185547 CCTCTAAAACAAGGTTAGGTCGG - Intergenic
1113179565 13:107609571-107609593 CCTCTCACATAGACTGAGGTAGG - Intronic
1114382144 14:22218209-22218231 ACTGTAAAACAGCCTCAGGTAGG - Intergenic
1114463994 14:22907706-22907728 ACTATAAAACAGCCTTAGGCTGG + Intronic
1115286266 14:31716209-31716231 CCTGTCAAACAGACTCAGGCAGG - Intronic
1117113536 14:52485027-52485049 ACTGTAAAACAGCCTCAGGTAGG + Intronic
1117246955 14:53896010-53896032 CCTCTAAGACACACTGCGGTTGG + Intergenic
1119607514 14:76033422-76033444 CCTCCAAAACAGACGGAGCTTGG + Intronic
1126196868 15:45941342-45941364 CCTATAAAACAGCCTCAGGCAGG - Intergenic
1126702028 15:51376917-51376939 ACTGTAAAACAGCCTTAGGCAGG - Intronic
1134155816 16:11842668-11842690 CCTTTAAAACATATTTAGGCTGG - Intronic
1134789421 16:16975521-16975543 ACTGTAAAACAGACTCAGGTAGG + Intergenic
1136422529 16:30144430-30144452 ACTATAAAACAGAATTAGGCTGG + Intergenic
1136720021 16:32312437-32312459 ACTATAAAACAGCCTCAGGTAGG - Intergenic
1136838398 16:33518716-33518738 ACTATAAAACAGCCTCAGGTAGG - Intergenic
1136843401 16:33556884-33556906 ACTATAAAACAGCCTCAGGTAGG - Intergenic
1136995111 16:35183675-35183697 CCCCTAGAACAGAGGTAGGTTGG - Intergenic
1137305783 16:47198589-47198611 ACTGTAAAACAGCCTCAGGTAGG + Intronic
1138799126 16:60004627-60004649 ACTGTAAAACAGCCTTAGGCAGG - Intergenic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1140741746 16:77947754-77947776 CCTCAAAAACAGAGGGAGGTAGG - Intronic
1203006410 16_KI270728v1_random:205332-205354 ACTATAAAACAGCCTCAGGTAGG + Intergenic
1203153566 16_KI270728v1_random:1857182-1857204 ACTATAAAACAGCCTCAGGTAGG - Intergenic
1143685615 17:8513208-8513230 CCTCATAAACAGACATAGGAAGG + Intronic
1146466624 17:33091294-33091316 CCTGAAAAACAGACTCAGATGGG + Intronic
1148428256 17:47619624-47619646 CCTTTATAACAGACTGAAGTTGG + Intronic
1148920518 17:51027847-51027869 ACTATAAAACAGCCTCAGGTAGG + Intronic
1148971550 17:51487643-51487665 CCTCTATAACAGAATTATTTTGG - Intergenic
1149156564 17:53637524-53637546 TCTCTACAACAGCCTTAGGCTGG + Intergenic
1154018439 18:10641104-10641126 CCTGTAAAACAGCCTCAAGTAGG - Intergenic
1154186434 18:12188471-12188493 CCTGTAAAACAGCCTCAAGTAGG + Intergenic
1155032991 18:22000773-22000795 CCTATAAGACAGACTAAGGAAGG - Intergenic
1155822903 18:30400669-30400691 ACTGTAAAACAGCCTTAGGCAGG + Intergenic
1156103349 18:33625944-33625966 CATCTAAAACAAAATTAAGTGGG - Intronic
1156615081 18:38773232-38773254 ACTCTAAAACAGCCTCAGGCAGG - Intergenic
1158003592 18:52646915-52646937 CCTCCTAAATAGACTTAGGATGG - Intronic
1165321456 19:35087916-35087938 TATCTAAAAAAGAATTAGGTGGG + Intergenic
928221990 2:29411294-29411316 CCTCTAGAACAGCCTCAGGCAGG - Intronic
930487741 2:52028391-52028413 TCTCTAGAACATACTTATGTTGG + Intergenic
930525019 2:52517838-52517860 CCTGTAAAACAGCCTCAGGTAGG - Intergenic
930892810 2:56410836-56410858 ACTGTAAAACAGCCTCAGGTAGG - Intergenic
931252188 2:60542725-60542747 CCTCTAAAAAATACTCAGTTTGG + Intronic
932690735 2:73911125-73911147 ACTGTAAAACAGCCTTAGGCAGG - Intronic
933569968 2:83998733-83998755 CCTCATAAAGAAACTTAGGTTGG - Intergenic
934682267 2:96293060-96293082 CCTCTGGAACAGACATATGTGGG - Exonic
934698544 2:96419168-96419190 CCTCCAAAAATGACTTAGGGAGG + Intergenic
936743719 2:115547603-115547625 CCTCTACAAAAGAATTAGCTGGG + Intronic
940717429 2:157243257-157243279 ACTATAAAACAGTCTCAGGTGGG - Intergenic
941169267 2:162117843-162117865 CATATAAAACAGACCTAGATAGG + Intergenic
945730747 2:213530105-213530127 ACTCTAAAACAGCCTAAGGCAGG - Intronic
946593971 2:221285470-221285492 CCCCTAAAACAGAGTTAGAAGGG + Intergenic
1168792387 20:588142-588164 ACTGTAAAACAGCCTCAGGTAGG - Intergenic
1168950587 20:1798112-1798134 CCTCTAAAAAAAAATTAGCTGGG + Intergenic
1169685268 20:8264349-8264371 ACTGTAAAACAGTCTCAGGTGGG - Intronic
1170881480 20:20300301-20300323 ACTCTAAAACAGTCTCAGATAGG + Intronic
1174670527 20:52303453-52303475 CCTGAAAAACAGACTTCGGAAGG - Intergenic
1175301299 20:57944902-57944924 CCTGTAAAGCAGCCTTAGGCAGG - Intergenic
1179103148 21:38374675-38374697 CCCCTACAACAGACTATGGTAGG + Intergenic
1179111731 21:38452710-38452732 CCTTCAGAACAGACTTAGCTGGG + Intronic
1179164934 21:38927876-38927898 CCTCTCCAACAGACTTGAGTTGG + Intergenic
1179891146 21:44335635-44335657 CCTCCAACACAGACTGAGGGCGG - Intronic
1181498785 22:23303550-23303572 CCTCTTAAACAGACTTGGAGAGG + Intronic
1182214449 22:28704077-28704099 ACTCTAAAACACACTTGGGTCGG + Intronic
1182675749 22:32038147-32038169 ACTGTAAAACAGCCTCAGGTAGG + Intergenic
1182975052 22:34616047-34616069 ACTGTAAAACAGCCTCAGGTAGG + Intergenic
1183561511 22:38577976-38577998 ACTGTAAAACAGCCTCAGGTAGG - Intergenic
949665026 3:6328765-6328787 CCCAAAAAAAAGACTTAGGTAGG + Intergenic
951527544 3:23668331-23668353 GCTCTAAATCAGACTTAAGCAGG - Intergenic
954585026 3:51726439-51726461 ATTGTAAAACAGCCTTAGGTGGG + Intergenic
957479955 3:80779987-80780009 CCATTAATACACACTTAGGTTGG - Intergenic
958694240 3:97507670-97507692 CCTCTTAAAATGACTTAGGGAGG + Intronic
959628888 3:108485405-108485427 CCTTTAAAAGAGAATTAGGAAGG + Intronic
961680942 3:128599649-128599671 TCTCTAAAAAAAACTTAGCTGGG + Intergenic
965860365 3:173141675-173141697 ACTCTAAAACATACATAGGTAGG - Intergenic
966438496 3:179917307-179917329 GCTGTAAAACAGCCTTAGGCAGG - Intronic
968645022 4:1736121-1736143 CCTCTAAAACAGAGGTCGGCAGG + Intronic
970461107 4:16275776-16275798 CCACCAAAACAGCCTGAGGTTGG + Intergenic
970882133 4:20944749-20944771 CCTCCAAAACAGATTTATTTAGG - Intronic
971204504 4:24550709-24550731 ACTGTAAAACAGGCTTAGGCAGG - Intronic
973576354 4:52293608-52293630 ACTGTAAAACAGCCTTAGGCAGG - Intergenic
973900844 4:55469418-55469440 ACTCTAAAACAGCCTCAGGCTGG + Intronic
974329618 4:60461190-60461212 CTTATAAAACAAAGTTAGGTTGG + Intergenic
980223963 4:129956891-129956913 ACTGTAAAACAGGCTTAGGCAGG + Intergenic
980867619 4:138571892-138571914 ACTGTAAAACAGCCTTAGGGAGG - Intergenic
981614334 4:146631289-146631311 CCTCTGTAACAGATTTTGGTTGG - Intergenic
981811325 4:148778973-148778995 CCTGTAAAACAGCCTCAGGCAGG - Intergenic
985328435 4:188798598-188798620 CCTCTAAAACAGCCTTCTATTGG + Intergenic
988102786 5:26704310-26704332 ACTCTAAAACAGCCTCAGGTAGG + Intergenic
989221314 5:38968759-38968781 ACTGTAAAACAGCCTCAGGTAGG + Intronic
989674914 5:43962453-43962475 CCTCTAAAAATGAGTTAGGGAGG + Intergenic
990057227 5:51598390-51598412 ACTGTAAAACAGCCTTAGGCAGG + Intergenic
990813939 5:59761751-59761773 ACTATAAAACAGCCTCAGGTAGG - Intronic
990854658 5:60250811-60250833 ACTGTAAAACAGCCTCAGGTAGG + Intronic
992453526 5:76894754-76894776 CCACTAAAACAAAATTAGCTGGG - Intronic
994144386 5:96376801-96376823 ACTGTAAAACAGCCTCAGGTAGG + Intergenic
994585224 5:101699472-101699494 ACTGTAAAACAGACTTAAGCAGG + Intergenic
996504115 5:124250066-124250088 ACTGTAAAACAGCCTCAGGTAGG - Intergenic
998027298 5:138829428-138829450 CTTCAAAAACAGACTTTGGTGGG + Intronic
998927655 5:147144135-147144157 ACTGTAAAACAGCCTTAGGCAGG + Intergenic
999345164 5:150811858-150811880 ACTGTAAAACAGCCTCAGGTAGG - Intergenic
1002316732 5:178348722-178348744 TCCCTAAATCAGACTTAGGAAGG - Intronic
1003786378 6:9491305-9491327 CCTCTGAGACAGTCTTTGGTGGG - Intergenic
1004108272 6:12686992-12687014 GCTGTAAAACAGACATAAGTAGG + Intergenic
1005009961 6:21326540-21326562 ACTGTAAAACAGCCTTAGGCAGG - Intergenic
1005445059 6:25914445-25914467 CCTCTAAATCAGACTCTGGTAGG - Intronic
1006442253 6:34059923-34059945 CCACAAAAAGAGACTGAGGTAGG + Intronic
1008901646 6:56625757-56625779 ACTGTAAAACAGACTCAGATAGG + Intronic
1011481827 6:87801812-87801834 CCTCTAAAATATACATATGTTGG - Intergenic
1012266318 6:97148358-97148380 ACTGTAAAACAGACTCAGGCAGG + Intronic
1015427890 6:133093379-133093401 CCTTTAAAACAGACTCAGCCAGG - Intergenic
1017204833 6:151793389-151793411 CCTGTAAAACAGCATTAGGCAGG - Intronic
1017594803 6:156016935-156016957 CCGCAAAAGCAGACTCAGGTTGG + Intergenic
1021162394 7:17291532-17291554 CTTTTTAAACAGACTTATGTTGG + Intergenic
1028438914 7:90836563-90836585 ACTGTAAAACAGCCTTAGGCAGG - Intronic
1028453617 7:91014574-91014596 CCTCTACATCACACTTAGCTTGG - Intronic
1032891803 7:136203981-136204003 ACTGTAAAACAGCCTTAGGCAGG - Intergenic
1033307234 7:140233851-140233873 CCTCTAAAACAAAATTAGCCAGG - Intergenic
1037395951 8:18443401-18443423 ACTGTAAAACAGCCTTAGGCAGG + Intergenic
1040711216 8:50191526-50191548 CCTCTAATACAGAATTATGAGGG + Intronic
1042579009 8:70255963-70255985 CATCCAAAACAGACTTAGGAAGG - Intronic
1044508247 8:93046032-93046054 CCTCAAAAACTGAGTTAGGGAGG + Intergenic
1045858162 8:106788383-106788405 ACTGTAAAGCAGACTTAGGCAGG - Intergenic
1047882120 8:129206506-129206528 GCTCTCAACCAGACCTAGGTAGG + Intergenic
1050364939 9:4865086-4865108 CACCTAAAACAGCCTGAGGTTGG - Intronic
1050708619 9:8433416-8433438 ACTTTAAAACAGCCTTAGGTAGG + Intronic
1051128265 9:13830389-13830411 ACTGTAAAACAGCCATAGGTTGG - Intergenic
1051263898 9:15292547-15292569 ACTCTAAAACAGCCTCAGGCAGG + Intronic
1055393795 9:75851796-75851818 ACTGTAAAACAGCCTTAGGCAGG - Intergenic
1056792909 9:89637795-89637817 CCTCTAAATCTGAACTAGGTGGG + Intergenic
1060129706 9:121083578-121083600 ACTATAAAACAGACTCAGGCAGG - Intronic
1186510780 X:10128415-10128437 CCTCCACCACAGACCTAGGTAGG + Intronic
1186577080 X:10778010-10778032 ACTGTAAAACAGCCTTAGGCAGG - Intronic
1188850118 X:35121764-35121786 ACTGTAAAACAGACTCAGGCGGG - Intergenic
1195424298 X:104710984-104711006 ACTGTAAAACAGCCTCAGGTGGG + Intronic
1196473462 X:116055627-116055649 CATCTAAAACAGAATTAAGAGGG - Intergenic
1196938535 X:120753180-120753202 CCTCAAAATCAGAATTTGGTGGG + Intergenic
1197687625 X:129458707-129458729 CCTGTCATTCAGACTTAGGTAGG - Intronic
1198630239 X:138629387-138629409 ACTCTAAATGAGATTTAGGTGGG - Intergenic
1199829683 X:151537242-151537264 CCTAGTAAACAGACATAGGTGGG + Intergenic
1199940608 X:152623207-152623229 ACTATAAAACAGCCTCAGGTAGG + Intergenic
1200252562 X:154561512-154561534 ACTCTAAAGCAGGCTTTGGTGGG - Intronic
1200265205 X:154642904-154642926 ACTCTAAAGCAGGCTTTGGTGGG + Intergenic
1200527477 Y:4292117-4292139 CCTGTAAAACAGCCTCAGGCAGG + Intergenic