ID: 1103281124

View in Genome Browser
Species Human (GRCh38)
Location 12:119758830-119758852
Sequence TGTACTCTGAGGATCACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103281124 Original CRISPR TGTACTCTGAGGATCACAGA TGG Intronic
900460641 1:2800847-2800869 GGTACTCTGAGGACCAGACATGG - Intronic
900707447 1:4089528-4089550 GGGACTCTGAGTACCACAGATGG - Intergenic
901181656 1:7346277-7346299 AGTAACCTGAGGATCAGAGAGGG - Intronic
902379745 1:16047106-16047128 TGGACACCGAGCATCACAGAGGG - Intronic
903302330 1:22388262-22388284 AGCACTCTGAGGCACACAGAGGG + Intergenic
903552864 1:24169998-24170020 GGTACTCTGTGGATGTCAGAGGG + Intronic
905282115 1:36855904-36855926 TGGACACTGAGGCTCAAAGAGGG + Intronic
907752865 1:57280338-57280360 TGTACTCTGACCATCCTAGAAGG + Intronic
908072957 1:60483721-60483743 TGTGCTCTGGGAATCAGAGAAGG - Intergenic
910807164 1:91200234-91200256 TGTGCTTTGAGGTTCACAGCTGG - Intergenic
911663194 1:100526295-100526317 AGTTTTCTGAGGAACACAGACGG + Intergenic
911705953 1:101013103-101013125 TGTATTCTGATGTTCACACATGG - Intronic
912449988 1:109762739-109762761 AGGACTCTGAGGCTCAAAGACGG + Intronic
916026676 1:160839044-160839066 TGAATTCTGAGGAATACAGAAGG + Exonic
918122501 1:181551661-181551683 TAGACTCTGAGGACAACAGAAGG + Intronic
918440130 1:184558663-184558685 TTTACTCGAAGGATCCCAGATGG - Intronic
920165564 1:204033178-204033200 TGTGCTCCGAGGATCCCAGGAGG - Intergenic
923361371 1:233214699-233214721 TGCAATTTGAGGATCAGAGATGG - Intronic
1066291731 10:34020562-34020584 TGCACTCTGTGGCTCACTGATGG + Intergenic
1066448246 10:35503838-35503860 TATTATCTGAGGAACACAGAGGG - Intronic
1066694335 10:38064572-38064594 TTTCCTCTGGAGATCACAGATGG - Intronic
1071133303 10:82421439-82421461 TGTACTCTTAGCATGACACATGG + Intronic
1071374403 10:84988004-84988026 GATAATCTGAAGATCACAGAAGG + Intergenic
1073319891 10:102608804-102608826 TGGACTCTGAGGAGGACAGAGGG - Intronic
1074458605 10:113616512-113616534 TGAATTCTGAGAAACACAGATGG - Intronic
1075613023 10:123868518-123868540 TGTACTCTGATGATCACTCTTGG - Intronic
1078672895 11:13380699-13380721 TGTTTTCTGTGGATCAAAGATGG + Intronic
1081260432 11:40953444-40953466 TGTATTCAGAGGTTCAGAGAAGG - Intronic
1082254601 11:50019639-50019661 TATACTCTCAGAAGCACAGAGGG + Intergenic
1084103470 11:66965315-66965337 TTTACCCTGAGGATCTCATAAGG - Intergenic
1086663525 11:89451784-89451806 TTACCTCCGAGGATCACAGAAGG - Exonic
1090299745 11:125625525-125625547 AGGACTGTGAGGATCACAGTCGG - Exonic
1090536106 11:127643622-127643644 TGTCGTCTGATGATCACAAATGG + Intergenic
1092166206 12:6343793-6343815 TCTCATCTGCGGATCACAGAGGG - Intergenic
1093907426 12:24709635-24709657 TGTATTCTGAGGATCAGAACAGG - Intergenic
1094418422 12:30242618-30242640 TTTGCTCACAGGATCACAGAAGG - Intergenic
1096049809 12:48597664-48597686 TGGACTCTCAGGAACACAGAAGG + Intergenic
1096872230 12:54600391-54600413 TGTATTCTGAGCTTCAAAGAAGG + Intergenic
1097030773 12:56087804-56087826 ATTACACTGAGGAGCACAGATGG - Exonic
1097199043 12:57262649-57262671 TGTCCTCTGAAGGTGACAGAGGG + Intronic
1097434050 12:59539118-59539140 ATTACTCCGAAGATCACAGAGGG + Intergenic
1097750679 12:63349028-63349050 TGTACTCTAAGGCTCAGAGCAGG - Intergenic
1101553982 12:105789594-105789616 TGTTCTCTGAGAAGCACAGAGGG + Intergenic
1101654650 12:106709110-106709132 TGTACTCTGCTGGTCACTGATGG - Intronic
1101818182 12:108162020-108162042 GGGACACTGAGGCTCACAGAGGG + Intronic
1103174224 12:118847982-118848004 TCTACTCTGGAAATCACAGAGGG - Intergenic
1103186468 12:118962000-118962022 TGTAGACTGAGGCTCAGAGAGGG + Intergenic
1103281124 12:119758830-119758852 TGTACTCTGAGGATCACAGATGG + Intronic
1108375905 13:49814130-49814152 TGGACTCTGAGTATAGCAGATGG + Intergenic
1108416255 13:50200685-50200707 TGGACTCTGAGGAGCACTGGCGG + Intronic
1111463225 13:88573805-88573827 TGTACTCAGAGTATCTGAGAAGG + Intergenic
1113987052 13:114325543-114325565 TCTATTCTCAGAATCACAGAAGG + Exonic
1114645992 14:24256436-24256458 TGTCCTCTGGGGGTCACAGATGG - Intronic
1115297347 14:31843779-31843801 TGTACTCTGGGAGTCAGAGAGGG - Intronic
1116568060 14:46477348-46477370 TGTCCTTTCAGGAACACAGATGG - Intergenic
1116780320 14:49229782-49229804 TGTACTATGAGGGAAACAGAGGG - Intergenic
1117495208 14:56295553-56295575 ATTACTCTGATGATGACAGACGG - Intronic
1119210478 14:72827828-72827850 TGTACTCCGAGCATCTCAGGAGG + Intronic
1119984459 14:79121021-79121043 TCTACTCTGAGCATTACAGATGG + Intronic
1121110349 14:91308398-91308420 TGTGCTCTTAGAAGCACAGATGG - Exonic
1121572825 14:94960385-94960407 TGGCCTCTGAGGATTACAGTAGG + Intergenic
1122323424 14:100868715-100868737 TATTCTCTGAGGATCACACAGGG + Intergenic
1126719799 15:51566474-51566496 TGCACTCTGAGGAACACTAAAGG - Intronic
1126858274 15:52859784-52859806 TGTACTGTGAGGATAAGGGAGGG + Intergenic
1127043713 15:55004083-55004105 AGTGTTCAGAGGATCACAGAAGG + Intergenic
1128704028 15:69825573-69825595 GCTATTCTGAGGATCAGAGATGG - Intergenic
1128815380 15:70604386-70604408 TTTACACTGAGGAACCCAGAAGG - Intergenic
1128823509 15:70685759-70685781 TTTAATTTTAGGATCACAGAGGG - Intronic
1129743417 15:78001292-78001314 TGGGCACTGAGGATGACAGATGG - Intronic
1131662803 15:94536750-94536772 TGAAGTCTGTGAATCACAGAAGG + Intergenic
1132286023 15:100663208-100663230 TGTGATGTGAGGATCACAGTGGG - Intergenic
1132293298 15:100718117-100718139 TGTACTCTGAGGATGCCAACAGG - Intergenic
1134022806 16:10933091-10933113 TGTGCTCTGATGATGTCAGAAGG - Intronic
1136613249 16:31379990-31380012 TTTTCTCTGAGGAGCACCGAAGG - Exonic
1139055642 16:63180500-63180522 AGGAGTATGAGGATCACAGAGGG + Intergenic
1139510110 16:67422813-67422835 TCTATTCTGGGGACCACAGAGGG - Intergenic
1140267405 16:73432735-73432757 GATGCTCTTAGGATCACAGACGG - Intergenic
1143205896 17:5139096-5139118 TGTAGTCTGCTGATCCCAGAGGG - Intronic
1143289320 17:5817027-5817049 TGTACACTGAGGAAAACAGTTGG - Intronic
1146842718 17:36166699-36166721 TGTAGTCTGCTGATCCCAGAGGG + Intronic
1146855031 17:36254658-36254680 TGTAGTCTGCTGATCCCAGAGGG + Intronic
1146865589 17:36333717-36333739 TGTAGTCTGCTGATCCCAGAGGG - Intronic
1146870931 17:36378551-36378573 TGTAGTCTGCTGATCCCAGAGGG + Intronic
1146878289 17:36429633-36429655 TGTAGTCTGCTGATCCCAGAGGG + Intronic
1146882238 17:36450779-36450801 TGTAGTCTGCTGATCCCAGAGGG + Intergenic
1147068458 17:37934329-37934351 TGTAGTCTGCTGATCCCAGAGGG - Intronic
1147073815 17:37979175-37979197 TGTAGTCTGCTGATCCCAGAGGG + Intronic
1147079981 17:38013866-38013888 TGTAGTCTGCTGATCCCAGAGGG - Intronic
1147085336 17:38058713-38058735 TGTAGTCTGCTGATCCCAGAGGG + Intronic
1147095930 17:38137826-38137848 TGTAGTCTGCTGATCCCAGAGGG - Intergenic
1147101283 17:38182679-38182701 TGTAGTCTGCTGATCCCAGAGGG + Intergenic
1149026941 17:52037660-52037682 TGTCATCTGGGGATCACAGAGGG - Intronic
1149594785 17:57858399-57858421 TGCAATCTGTGGAGCACAGAAGG - Intergenic
1149845879 17:60009185-60009207 TGTAGTCTGCTGATCCCAGAGGG + Intergenic
1150084230 17:62265765-62265787 TGTAGTCTGCTGATCCCAGAGGG + Intergenic
1153783881 18:8517272-8517294 TATAGTCTGAGCTTCACAGAAGG + Intergenic
1154361038 18:13660881-13660903 TGTACAAAGAGGAGCACAGACGG + Intergenic
1155242759 18:23879179-23879201 GCTCCTCTGAGGCTCACAGACGG + Intronic
1158410337 18:57199557-57199579 GGAACTCTGGGGATCAGAGAGGG + Intergenic
1161805269 19:6439923-6439945 TGTAAACTGAGGCTCAAAGAGGG + Intronic
1165565152 19:36719692-36719714 TGTTCTCTGATGATCAGTGAGGG - Exonic
1166075373 19:40411082-40411104 TGGAAACTGAGGCTCACAGAGGG + Intronic
1166365748 19:42277721-42277743 GGTAGACTGAGGATCAGAGAAGG + Intronic
1167351482 19:48977774-48977796 TCTATTCTGAGGTCCACAGAAGG - Intronic
1168322909 19:55521084-55521106 AGGACTCTGAGGCTCAGAGAGGG + Intergenic
925697343 2:6594949-6594971 TGCTCTCTGAGGAACACTGAAGG - Intergenic
926306185 2:11638910-11638932 GGTAAACTGAGGATCAGAGAGGG + Intronic
927428938 2:23010041-23010063 TGTATTGTGATGATGACAGAAGG + Intergenic
928023879 2:27724182-27724204 TGTACCCTGACATTCACAGAGGG - Intergenic
928430799 2:31216996-31217018 TTGACTCTGAGGATCCCATAAGG + Intronic
929577374 2:43060531-43060553 AGTACTCTGAGGCTCAGAGAGGG + Intergenic
930252645 2:49052765-49052787 TTAACTCTCAGAATCACAGAAGG + Intronic
930686107 2:54310029-54310051 TGTAGTTTGAGGATGAAAGAAGG - Intergenic
930881406 2:56274872-56274894 TTTTCTCTGTGGATTACAGATGG + Intronic
931888044 2:66639477-66639499 TGTACTATGATATTCACAGAAGG + Intergenic
932047882 2:68368342-68368364 TGTAAGATGAGGATCACATAGGG - Intronic
932490802 2:72119013-72119035 TCAACTCTGAGGATCACAGCAGG + Intergenic
933214020 2:79605797-79605819 TGTACTCTGAGCTGCTCAGAAGG + Intronic
933781139 2:85802201-85802223 TGTCCGCTCAGGAACACAGATGG + Intergenic
934944810 2:98532561-98532583 TGTACTAACAGGATCCCAGATGG + Intronic
936378122 2:111960070-111960092 TTGACTCTGAGGACTACAGAAGG + Intronic
936685161 2:114819349-114819371 AGAAAACTGAGGATCACAGAGGG - Intronic
936690560 2:114883293-114883315 TGTAGTCACAGGATCACACATGG + Intronic
937777339 2:125794071-125794093 TGCTCTCTGTGGTTCACAGAGGG - Intergenic
939378789 2:141407325-141407347 TTTACTATGAGGATCACATGTGG - Intronic
940629421 2:156219115-156219137 TGTACTCAGTGGATCACTGTTGG - Intergenic
940694330 2:156959684-156959706 TGGACACTGAGGAGCACAGGAGG - Intergenic
941583842 2:167332124-167332146 TGTACTCTGAGATTAACATAGGG - Intergenic
943506538 2:188767661-188767683 TGTGCTCTGAGAATCAGAGTTGG + Intronic
946598640 2:221334670-221334692 TGCAGTCTGTGGCTCACAGAAGG - Intergenic
946711811 2:222514642-222514664 TCAACTCAGAGGATTACAGATGG + Intronic
947868873 2:233421314-233421336 TGTGCTCTGAGGACAGCAGACGG - Intronic
1170071309 20:12372120-12372142 TGTTCTCTGAGGAGCACAGCTGG + Intergenic
1171237489 20:23539377-23539399 TGTAGTCTGTGGAGGACAGAGGG + Intergenic
1173329062 20:42059129-42059151 AGGACTCTGAGGGTCAGAGAGGG + Intergenic
1175682566 20:61001337-61001359 TGTTCTCTCAGGATCCCAGCTGG - Intergenic
1175814296 20:61875491-61875513 TGGACTCCAAGGATCAGAGATGG + Intronic
1176984358 21:15419393-15419415 TATACTCTTGGGATCACAGCAGG - Intergenic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1178852883 21:36227881-36227903 TGTACTCTGAGGGGCAGAAATGG + Intronic
1178929430 21:36804658-36804680 TGCCCTTTGAGGACCACAGAGGG - Intronic
1179479535 21:41668728-41668750 TGCAGTCTGGGGATCACAGAAGG - Intergenic
1180149963 21:45942409-45942431 TGAACTCTGAGGAGCACAGAGGG - Exonic
1181546405 22:23605073-23605095 TGTACAATGGGGATCACAGCAGG + Intergenic
1181777547 22:25170498-25170520 TGTACTGTGAGGAGGAGAGAGGG + Intronic
1181895801 22:26106364-26106386 TTCAGTCTGAGGATCAGAGAAGG - Intergenic
1183177600 22:36235880-36235902 GGGAATCTGAGGATCACAGTGGG + Intronic
950054554 3:10014030-10014052 TGTACTTTCAGAAACACAGAAGG - Intergenic
950306681 3:11920391-11920413 TGTACTTTCAGAAACACAGAAGG - Intergenic
951727842 3:25780121-25780143 TGTAATTTGAGAATCACAGATGG + Intronic
952505913 3:34006750-34006772 TGTAAGCTGAGGACTACAGAAGG + Intergenic
952949456 3:38508482-38508504 TATACTGTGAGGCTTACAGAGGG + Intronic
956322874 3:68018180-68018202 TGTACATTGATGATCACAGATGG + Intronic
956426671 3:69143198-69143220 TGTAATCTGGGGATTATAGAGGG + Intergenic
956966606 3:74469095-74469117 TCTAATCTTAGAATCACAGAAGG + Intronic
957252232 3:77787834-77787856 TATACTCTGAGGAGAATAGAAGG + Intergenic
957363429 3:79188989-79189011 TGCACTTTCAGGTTCACAGAAGG - Intronic
960365111 3:116761638-116761660 GGGACTCTGAGAATCAGAGAAGG + Intronic
960577776 3:119244351-119244373 TGTACTCAGTGTATCACAAAAGG + Intergenic
962262345 3:133920334-133920356 TCCAATCTGAGGACCACAGAGGG + Intergenic
962396433 3:135018704-135018726 TGTCCTGCGAGGCTCACAGATGG - Intronic
962986717 3:140543088-140543110 TGTACCCTGAGGATATCACATGG + Intronic
966356711 3:179088003-179088025 TGTAATCGTAGGATCAGAGAAGG + Intergenic
969079368 4:4606586-4606608 TGGACACTGAGAAGCACAGAGGG - Intergenic
969587084 4:8100377-8100399 AGGACTCTGAGGTTCAGAGAGGG - Intronic
971649959 4:29258739-29258761 GCTATTCTGAGGCTCACAGATGG + Intergenic
974326485 4:60420987-60421009 TGTTCTCTGAGCTTCCCAGATGG + Intergenic
974344307 4:60658988-60659010 TGTACTGTGAGCATTACAGATGG - Intergenic
976710867 4:88070447-88070469 TGCACTCTGAGGAACAGAGAGGG - Intronic
977286830 4:95118088-95118110 TGAGCTCTGAGGATCTCAGGTGG + Intronic
978177103 4:105745588-105745610 TGTCCTCTGAGTATAAAAGAGGG + Intronic
979387681 4:120088552-120088574 TGGAGTCTTATGATCACAGAAGG - Intergenic
982243587 4:153325675-153325697 TGTACTATTAGGATCTCATATGG - Intronic
984202708 4:176745653-176745675 TGTCCTGAGAAGATCACAGATGG + Intronic
986394371 5:7314055-7314077 TGTTATCTGTGGATCACTGATGG + Intergenic
987608888 5:20176115-20176137 TGTTTTCTGAGGAACACAGAAGG + Intronic
989800408 5:45531504-45531526 TGTATTCTGAGGACAACAGAGGG - Intronic
991178260 5:63716796-63716818 TATATTCTGAAGATTACAGATGG - Intergenic
991388497 5:66116569-66116591 TTTATTCTGAGGATAACAGTGGG + Intergenic
992372976 5:76163979-76164001 TGGACTCTGAGGATTGTAGAAGG - Intronic
994643266 5:102436488-102436510 TGGACTCTGGGTATCAGAGATGG + Intronic
994934117 5:106230866-106230888 TGTTATCTGTGGATCACTGATGG - Intergenic
995865193 5:116682934-116682956 TGTGCTCTCAGCCTCACAGAAGG - Intergenic
995941186 5:117586611-117586633 TGTAGTCTGAAGATAAAAGACGG - Intergenic
996755581 5:126931721-126931743 TGTAACATGAGGATAACAGAAGG + Intronic
999527648 5:152425040-152425062 TGTACTCCAAGTATCACAAATGG + Intronic
999593045 5:153170233-153170255 TGTAGTCTGAGCAACTCAGAAGG - Intergenic
1000252626 5:159510122-159510144 GGTACTCTGAGTCTCACAAAGGG + Intergenic
1001885112 5:175282919-175282941 TTTACACTGAGGATCTCAAATGG + Intergenic
1003241031 6:4345973-4345995 AGTAGTCTGAGGGTCAAAGAGGG - Intergenic
1004170879 6:13294723-13294745 CTGACACTGAGGATCACAGACGG + Intronic
1005110571 6:22277009-22277031 TGTTCTCTGACTATAACAGAAGG - Intergenic
1005532837 6:26724668-26724690 TCTACTCTGAGGAGGTCAGATGG - Intergenic
1005535613 6:26753325-26753347 TCTACTCTGAGGAGGTCAGATGG + Intergenic
1005537958 6:26776996-26777018 TCTACTCTGAGGAGGTCAGATGG + Intergenic
1005895323 6:30172556-30172578 TGCACTCTGAGGTACAGAGAAGG - Exonic
1007115683 6:39341489-39341511 TGTCCTCTGAAGACCAGAGATGG - Intronic
1007597593 6:43060950-43060972 AGCACTATGGGGATCACAGAAGG - Intronic
1008550112 6:52620846-52620868 TGTGCTCTGAGAAACAGAGATGG - Intergenic
1008841026 6:55904507-55904529 TCTAGTCTCAGGATGACAGAGGG + Intergenic
1009006653 6:57796953-57796975 TCTACTCTGAGGAGGTCAGATGG + Intergenic
1009008820 6:57819362-57819384 TCTACTCTGAGGAGGTCAGATGG + Intergenic
1014217474 6:118766706-118766728 TGTACTATGTTGAACACAGAGGG - Intergenic
1015703833 6:136065923-136065945 AGAACTCTGAAGATCACAGGGGG - Intronic
1016122974 6:140366732-140366754 TGTACTCTGATGATCAGAAGTGG - Intergenic
1017488431 6:154923522-154923544 TGTTCTCTGAGGATCACCAAGGG + Intronic
1017599797 6:156068192-156068214 TGTACTGTGAGGTTCTCAAAGGG - Intergenic
1018066632 6:160129118-160129140 TGGACTCTGGGGAGAACAGAGGG - Intronic
1018662215 6:166098693-166098715 CGTACTCCCAGGATCATAGATGG + Intergenic
1018746056 6:166763110-166763132 AGTAGTATCAGGATCACAGAAGG + Intronic
1020613536 7:10430149-10430171 TTTACTCTGAGGAACAGACAAGG + Intergenic
1022895419 7:34746032-34746054 TGTAGTCTGAGGACCTCTGAGGG - Intronic
1022917506 7:34972963-34972985 TGAATTCGGAGGATCACTGAAGG + Intronic
1026011734 7:66641594-66641616 ATTACTGTGAGGATCACAAAGGG - Exonic
1026841032 7:73670003-73670025 TTTCCTCTGAGGGCCACAGAGGG - Exonic
1028326627 7:89534846-89534868 TGTACTCTGTGGATCAAAGCTGG - Intergenic
1033854665 7:145545051-145545073 TGTAGGCTGATGAGCACAGATGG - Intergenic
1038030023 8:23629692-23629714 AGTTCTCTGAAGATCAGAGAAGG - Intergenic
1038189849 8:25310108-25310130 TTTACCCCTAGGATCACAGATGG + Intronic
1038197577 8:25382326-25382348 TGCATTCTGAGATTCACAGAAGG - Intronic
1038493404 8:27985624-27985646 AGTACACTGAGGCCCACAGAGGG + Intronic
1039979456 8:42395318-42395340 TATACTCTGAGAAACACAAAAGG - Intronic
1043104899 8:76095844-76095866 TGCACTGTGAGGATTCCAGAAGG - Intergenic
1044612436 8:94106904-94106926 TCTTCTCTGATCATCACAGAAGG + Intergenic
1045697171 8:104822674-104822696 TATGCTCTGAAGATCAGAGAGGG + Intronic
1048535382 8:135289581-135289603 TGAGCTCTGAGGATTTCAGAAGG - Intergenic
1048649353 8:136457166-136457188 TAGACTCTGAGGATTACAGAAGG + Intergenic
1049027687 8:140007019-140007041 TGTACACTCAGGATCTCAAATGG - Intronic
1053618298 9:39792085-39792107 TGTACTCAGAGGACCGCGGAGGG + Intergenic
1054265857 9:62915344-62915366 TGTACTCAGAGGACCGCGGAGGG - Intergenic
1054871426 9:70050210-70050232 TACACGCTGAAGATCACAGACGG - Intronic
1056077525 9:83056876-83056898 TGAATTCTGAGGGTCACAGCAGG + Intronic
1057511640 9:95684742-95684764 TGTCCTCTGTAGATCAAAGAAGG - Intergenic
1059600763 9:115775748-115775770 GAGACACTGAGGATCACAGAAGG + Intergenic
1060545314 9:124455923-124455945 TGTCCTCTGAGGCCCACAGGGGG - Intronic
1060762670 9:126269154-126269176 TGTCATCTCAGGTTCACAGAGGG - Intergenic
1061268596 9:129523209-129523231 AGTAGTCTGAGGTTCAAAGACGG - Intergenic
1185713546 X:2323376-2323398 AGTACTCTGAGTGTAACAGATGG - Intronic
1186050150 X:5583715-5583737 TGGACTCTGAGGTTCATAGTGGG + Intergenic
1186087437 X:6005623-6005645 TGTGCTTTGGGGGTCACAGAGGG - Intronic
1186119193 X:6340497-6340519 GGTGCTCTGAGAATCACAGCAGG - Intergenic
1186346468 X:8698259-8698281 TGTACACTAGGGATCATAGATGG - Intronic
1186601562 X:11042883-11042905 TTTACTCAGAGCATCACAGTAGG - Intergenic
1186798603 X:13070369-13070391 TGTTCTCTCAGGAGCACACACGG - Intergenic
1188019484 X:25141916-25141938 TCTACTCAGAGGATCAGAAAAGG + Intergenic
1194643986 X:96435842-96435864 TTGGCTCTGAGGGTCACAGAGGG + Intergenic
1197996285 X:132378376-132378398 TCTTCTCTGTTGATCACAGAGGG - Exonic
1199700403 X:150371303-150371325 TGTTCCCTGAGGTTCAGAGAAGG + Intronic
1200773978 Y:7153114-7153136 TGTAGTCTGAGGAACTCAGGAGG + Intergenic