ID: 1103281806

View in Genome Browser
Species Human (GRCh38)
Location 12:119764260-119764282
Sequence CTTCACATAGTGGAGTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103281802_1103281806 28 Left 1103281802 12:119764209-119764231 CCATGACAAAGAACCAAGAGAAA 0: 1
1: 0
2: 2
3: 46
4: 490
Right 1103281806 12:119764260-119764282 CTTCACATAGTGGAGTTGTCAGG 0: 1
1: 0
2: 0
3: 6
4: 126
1103281803_1103281806 15 Left 1103281803 12:119764222-119764244 CCAAGAGAAACAACAGAGCAGAA 0: 1
1: 0
2: 2
3: 49
4: 494
Right 1103281806 12:119764260-119764282 CTTCACATAGTGGAGTTGTCAGG 0: 1
1: 0
2: 0
3: 6
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103281806 Original CRISPR CTTCACATAGTGGAGTTGTC AGG Intronic
903431515 1:23305042-23305064 CTTTATATAGTAGATTTGTCAGG - Intronic
903807447 1:26015646-26015668 CTTAACAAAGTGGTGTTGACAGG + Intergenic
904803094 1:33110435-33110457 CTTCATATATTGGAATTATCAGG + Intronic
908752005 1:67432527-67432549 CTACACATAGAGGAATTTTCTGG + Intergenic
911745876 1:101441480-101441502 ATTCACATAGAGGACTTGACTGG + Intergenic
915507619 1:156367559-156367581 CTTCACCCTGTGGAGGTGTCAGG + Intronic
916278504 1:163023166-163023188 CTTTGCAGACTGGAGTTGTCTGG + Intergenic
916850789 1:168701259-168701281 CTTCACAGCCTGGAGTTGTTTGG - Intronic
917386158 1:174477237-174477259 GTTCACATACTTTAGTTGTCTGG - Intronic
919467120 1:197935339-197935361 CCTCACATATTAGAATTGTCAGG + Exonic
921537964 1:216375504-216375526 CTTCACATAATGGAATAGTTAGG + Intronic
923441437 1:234024371-234024393 CTTCACCCAGTGGAGGTGTTTGG + Intronic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
924929333 1:248713691-248713713 CTTCAAAAAATGGAGTTGTACGG - Intergenic
1063675146 10:8134833-8134855 CTTAAAATAGTGGAATTGGCCGG + Intergenic
1068781943 10:60929068-60929090 ATTCTCATATTGGAGTTCTCAGG - Intronic
1071250476 10:83813677-83813699 CTTCAAATACTGGAGTTCTGTGG + Intergenic
1073267658 10:102237884-102237906 CTTCTCATAGTGGGGTGGGCGGG - Intronic
1077618731 11:3699310-3699332 CTTCACATAGTGTCCATGTCAGG + Exonic
1080636279 11:34126495-34126517 TTTCTCAAAGTGGAGTTGTTGGG + Intronic
1081797277 11:45829486-45829508 CTTCCCATAGGGGATTGGTCTGG + Intergenic
1082066383 11:47904100-47904122 CTTCACATGGTGGAGGTGGAGGG - Intergenic
1083588068 11:63874794-63874816 CTTGACATGGTAGAGCTGTCAGG + Intronic
1092421713 12:8337268-8337290 CTGCACAAAGTGGATTTGGCTGG + Intergenic
1093270939 12:17060503-17060525 CTTCATATATTGGAGTTGGAGGG + Intergenic
1097035277 12:56119760-56119782 CTTCACATAGGGGAGTAGGAAGG + Intronic
1097565674 12:61265517-61265539 CACCACATAGTGGAGCTGTGAGG + Intergenic
1098370109 12:69749637-69749659 TTTCACATGGTGGACATGTCTGG + Intronic
1098493825 12:71112170-71112192 CATCACCTAGTGGAGCTGTGAGG - Intronic
1098986115 12:77014442-77014464 CTTCACAGAGTGGCCTTGTAGGG + Intergenic
1099552682 12:84067953-84067975 CTTCACATAGCCAAGTTTTCTGG - Intergenic
1099743816 12:86676166-86676188 TTTCACCTAGAGGAGTTTTCAGG - Intronic
1100402122 12:94241136-94241158 CTTAACATATTGGATTTATCTGG - Intronic
1101572185 12:105963881-105963903 CTGCAAATAGCGGAGTTGGCTGG - Intergenic
1101673440 12:106897317-106897339 CTGCCCATAGTGGAGTTGGGTGG + Intergenic
1103281806 12:119764260-119764282 CTTCACATAGTGGAGTTGTCAGG + Intronic
1104027228 12:125036838-125036860 CTTCACATGGTGGAGTCGAGGGG - Intergenic
1115351444 14:32399842-32399864 CTTCACATAATAGAATTATCAGG - Intronic
1116111991 14:40596831-40596853 CAGCACATAGTGGAATTATCTGG - Intergenic
1117349149 14:54863817-54863839 CTACACATATTGTAGTTGTGGGG + Intronic
1118632123 14:67715112-67715134 CTTCACAAAGTGGAGAAGGCTGG - Intronic
1121210663 14:92206123-92206145 CTGCCCATGGTGGAGTTGTGAGG - Intergenic
1123217067 14:106820022-106820044 CTTTACATATTTGAGTTCTCAGG + Intergenic
1123988874 15:25668514-25668536 CTTAGCATAGTGGAGTTGTGTGG - Intergenic
1124581634 15:30960972-30960994 TTTCAAAGAGTGGAGTTTTCTGG + Exonic
1126439213 15:48669701-48669723 TTTGACACAGTGGAGTTGTGAGG + Intergenic
1127037372 15:54933026-54933048 CTTCACAGACTGGCTTTGTCTGG + Intergenic
1127623000 15:60752335-60752357 CTTTACATACTGTATTTGTCAGG - Intronic
1130403620 15:83579390-83579412 CTTCACAAGGAGGGGTTGTCTGG + Intronic
1131955741 15:97734051-97734073 CTTCAGATAGTGGGGGTGTCGGG - Intergenic
1137827233 16:51509465-51509487 CTTCACATAGTGGAAGTAACAGG - Intergenic
1138104018 16:54277422-54277444 CTCCACATAGCGGGGTTTTCTGG - Intergenic
1140550836 16:75863683-75863705 CTTCAGCTAGTGCAGTTGCCAGG - Intergenic
1150321650 17:64219146-64219168 CTTCAGATAATGGAATTATCAGG + Intronic
1153148654 18:2063328-2063350 CTTCACAGACTGGCTTTGTCTGG - Intergenic
1153524819 18:5985005-5985027 CTTCCCATAGTGCTGTTATCTGG - Intronic
1156633645 18:38999529-38999551 CATCACATAGTGGGTTTGTTTGG + Intergenic
925040696 2:731464-731486 CCTCCCCTTGTGGAGTTGTCCGG + Intergenic
925064504 2:919286-919308 CTCCACAATTTGGAGTTGTCTGG + Intergenic
925422821 2:3725928-3725950 CTGCACCCAGTGGTGTTGTCGGG + Intronic
925804988 2:7639980-7640002 CTTCTCACAGTGGAGTTGTATGG - Intergenic
927065022 2:19462654-19462676 TTTCAAATAGTGGATTTTTCTGG + Intergenic
927431138 2:23027048-23027070 CTTCACTCAGTGTAGTAGTCAGG + Intergenic
931995251 2:67833478-67833500 CTTCACAACGTAGAGTTTTCAGG + Intergenic
932215944 2:69966020-69966042 CCTGACATAGTGGATTTGGCTGG - Intergenic
933611953 2:84445479-84445501 GTTCTCAAAGTGGAGGTGTCAGG - Intronic
935103761 2:100020691-100020713 CTTCAGGTAGTAGAGTTGACAGG - Intronic
935118883 2:100162759-100162781 CTGCCCATATTTGAGTTGTCTGG + Intergenic
946694304 2:222337270-222337292 CTTCAGATAGTACAGTTTTCAGG + Intergenic
946929646 2:224659179-224659201 CTTTACATGGAGGAGTTGTATGG - Intergenic
946977192 2:225166260-225166282 CTTCACCTTGTGGGGATGTCTGG + Intergenic
946981137 2:225217145-225217167 CTTCACATTGTGGAGATCTCTGG + Intergenic
1170160781 20:13308092-13308114 GATCACAGAGTGGAGTAGTCAGG - Intergenic
1176226192 20:64001069-64001091 CCTCACAGAGTGAAGATGTCTGG + Exonic
1177528425 21:22329032-22329054 CTTAACATAGTGTATTAGTCAGG + Intergenic
1178167545 21:29997101-29997123 CTACTTGTAGTGGAGTTGTCTGG - Intergenic
1183150868 22:36036444-36036466 CTTCACATAATGTGTTTGTCTGG + Intergenic
1184980490 22:48092035-48092057 CTGCCCACAGTGGAGTTGGCTGG - Intergenic
949260253 3:2097648-2097670 TTCCACATAGTGGAGATGTCAGG + Intergenic
950679927 3:14578085-14578107 CTCCACACAGTGGAGATGGCAGG - Intergenic
951127703 3:19003385-19003407 TTTCAGATAGTGGAGTTTTGTGG + Intergenic
952200480 3:31121590-31121612 CTTCACATTCTAGATTTGTCTGG + Intergenic
954763302 3:52892975-52892997 CCCCACATTCTGGAGTTGTCTGG - Intronic
956768333 3:72503380-72503402 CTTTAGATATTGGAGTTATCAGG + Intergenic
960083518 3:113566558-113566580 CTAAACATAGTGAAGTTGCCTGG - Intronic
960977311 3:123187815-123187837 AGTCACATCGTGGAGTGGTCAGG - Intronic
962227425 3:133625963-133625985 ATTGTCATAGTGGAGTTGACTGG - Intronic
963334906 3:143963466-143963488 CTTCTCCCAGTGGAGTTGTGTGG - Intergenic
964760920 3:160134338-160134360 CTTTACAGACTGGAGTTGTCAGG - Intergenic
965683151 3:171272956-171272978 CTTCACAGATTGGCTTTGTCTGG + Intronic
966165115 3:177008224-177008246 CTTCTCCCAGTGGAGTTGTGTGG - Intergenic
966754532 3:183356015-183356037 CTTCACAAAGTAGATTTGCCAGG + Intronic
971456958 4:26854075-26854097 TTTCACATAGTGTAGCTGCCAGG - Intergenic
972596617 4:40535227-40535249 CTTAAAATATTGGAGTTGTAAGG - Intronic
975077530 4:70230646-70230668 CTTCACATCGTGGATTTTTGGGG + Intronic
975174226 4:71269120-71269142 GCTGACATAGTGGAGTTGTTGGG + Intronic
979216165 4:118166578-118166600 CTTCTCATAGTATATTTGTCTGG - Intronic
982804525 4:159747976-159747998 CTTCACAGACTGGCTTTGTCTGG + Intergenic
989436614 5:41420886-41420908 CCTCACATAATGGAGTTATATGG - Intronic
990780281 5:59353274-59353296 GTTCTCTTATTGGAGTTGTCAGG + Intronic
991132481 5:63139017-63139039 CTTCTCATAGTGTATTTATCTGG + Intergenic
991223441 5:64242254-64242276 CTTCACAGACTGGCTTTGTCTGG - Intronic
992551144 5:77861490-77861512 ATTCACAGAGTGGCCTTGTCTGG + Intronic
994941314 5:106327398-106327420 ACTCACATAGTGAAGTTTTCTGG - Intergenic
996303168 5:122013159-122013181 CTTGACACAGTGAAGTTTTCAGG - Intronic
1000216871 5:159166780-159166802 CTTCACAGAGTGGACTTGGGGGG + Intronic
1004132641 6:12935169-12935191 CTTCACACCGTGGAGGTGTTTGG - Intronic
1005613381 6:27548252-27548274 CTCCACATAGGTGAGTTATCAGG + Intergenic
1008142277 6:47845705-47845727 CTTCACAAAGAGGACTTTTCTGG + Intergenic
1008419192 6:51277068-51277090 CTTCACATAGGGAAGGTGTGAGG + Intergenic
1012451746 6:99359835-99359857 CCTCACATTTTGGATTTGTCTGG + Intergenic
1014210750 6:118705549-118705571 CTTAACATTGTTGAGTTGTGAGG + Intronic
1016660149 6:146568993-146569015 CATCACATACTGGGGCTGTCAGG + Intergenic
1017577862 6:155825744-155825766 CTTCACGTAGTAGAGACGTCAGG + Intergenic
1021743058 7:23707191-23707213 CTTCTCATAATGGCTTTGTCTGG - Intergenic
1026086112 7:67264605-67264627 CTTCACATAGTGAAGTACCCAGG + Intergenic
1026691044 7:72550204-72550226 CTTCACATAGTGAAGTACCCAGG - Intergenic
1030454800 7:109760216-109760238 CTTCACATATTGGAGTATTGTGG - Intergenic
1039295759 8:36151793-36151815 TTTCACAAAGTGGAGTTTTAGGG + Intergenic
1040240844 8:45448013-45448035 CCTCACATAGAGCAGTTGTGCGG + Intergenic
1043109684 8:76164942-76164964 CTCTACATAATGGAGTTATCGGG - Intergenic
1043435122 8:80230468-80230490 TTTCACACAGTTGAGTTGGCAGG + Intronic
1044268562 8:90212231-90212253 ATTCAGATAGTAGAGGTGTCAGG - Intergenic
1047376205 8:124299868-124299890 ATTCACATATTGGAGTTCACTGG - Intergenic
1055544604 9:77356337-77356359 CTTTACATATTGCAGTTCTCCGG + Intronic
1061711984 9:132494268-132494290 CTTGATGTAGTGGGGTTGTCTGG + Intronic
1186160047 X:6767924-6767946 CTACACATACTGGAGTTTTGGGG + Intergenic
1187404191 X:18987778-18987800 ATTCACAGAGTGGACTTGTTTGG - Intergenic
1189269162 X:39738559-39738581 CTTCACAGAAAGGAGTTGCCGGG + Intergenic
1190693965 X:52935592-52935614 CTTCACATCGTGGAGGGGTGCGG - Intronic
1196799767 X:119532111-119532133 GTTGACTAAGTGGAGTTGTCAGG - Intergenic
1199076825 X:143534828-143534850 CTTCACTTCGTGGAGCTGTTGGG - Intergenic
1201553750 Y:15246687-15246709 CTGCACATATTGGAGTTCTGGGG + Intergenic