ID: 1103298859

View in Genome Browser
Species Human (GRCh38)
Location 12:119911804-119911826
Sequence GGGTATTGCTGGCATCTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103298859_1103298866 4 Left 1103298859 12:119911804-119911826 CCCACTAGATGCCAGCAATACCC No data
Right 1103298866 12:119911831-119911853 CCTCTGGTTCTGACAACCAAAGG No data
1103298859_1103298867 5 Left 1103298859 12:119911804-119911826 CCCACTAGATGCCAGCAATACCC No data
Right 1103298867 12:119911832-119911854 CTCTGGTTCTGACAACCAAAGGG No data
1103298859_1103298868 6 Left 1103298859 12:119911804-119911826 CCCACTAGATGCCAGCAATACCC No data
Right 1103298868 12:119911833-119911855 TCTGGTTCTGACAACCAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103298859 Original CRISPR GGGTATTGCTGGCATCTAGT GGG (reversed) Intergenic
No off target data available for this crispr