ID: 1103299102

View in Genome Browser
Species Human (GRCh38)
Location 12:119914045-119914067
Sequence TGTTAGGTAAAAACTTTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103299095_1103299102 11 Left 1103299095 12:119914011-119914033 CCCTGGCACTGACTTCTGCAGAA No data
Right 1103299102 12:119914045-119914067 TGTTAGGTAAAAACTTTGGGCGG No data
1103299090_1103299102 23 Left 1103299090 12:119913999-119914021 CCCCACCCAAGACCCTGGCACTG No data
Right 1103299102 12:119914045-119914067 TGTTAGGTAAAAACTTTGGGCGG No data
1103299092_1103299102 21 Left 1103299092 12:119914001-119914023 CCACCCAAGACCCTGGCACTGAC No data
Right 1103299102 12:119914045-119914067 TGTTAGGTAAAAACTTTGGGCGG No data
1103299094_1103299102 17 Left 1103299094 12:119914005-119914027 CCAAGACCCTGGCACTGACTTCT No data
Right 1103299102 12:119914045-119914067 TGTTAGGTAAAAACTTTGGGCGG No data
1103299093_1103299102 18 Left 1103299093 12:119914004-119914026 CCCAAGACCCTGGCACTGACTTC No data
Right 1103299102 12:119914045-119914067 TGTTAGGTAAAAACTTTGGGCGG No data
1103299096_1103299102 10 Left 1103299096 12:119914012-119914034 CCTGGCACTGACTTCTGCAGAAC No data
Right 1103299102 12:119914045-119914067 TGTTAGGTAAAAACTTTGGGCGG No data
1103299091_1103299102 22 Left 1103299091 12:119914000-119914022 CCCACCCAAGACCCTGGCACTGA No data
Right 1103299102 12:119914045-119914067 TGTTAGGTAAAAACTTTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103299102 Original CRISPR TGTTAGGTAAAAACTTTGGG CGG Intergenic
No off target data available for this crispr