ID: 1103302543

View in Genome Browser
Species Human (GRCh38)
Location 12:119939049-119939071
Sequence TCCCACAAACAGATGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103302543_1103302548 0 Left 1103302543 12:119939049-119939071 CCCACCACCATCTGTTTGTGGGA No data
Right 1103302548 12:119939072-119939094 GTATATATTGGCACAAATCTTGG No data
1103302543_1103302549 4 Left 1103302543 12:119939049-119939071 CCCACCACCATCTGTTTGTGGGA No data
Right 1103302549 12:119939076-119939098 ATATTGGCACAAATCTTGGACGG No data
1103302543_1103302550 5 Left 1103302543 12:119939049-119939071 CCCACCACCATCTGTTTGTGGGA No data
Right 1103302550 12:119939077-119939099 TATTGGCACAAATCTTGGACGGG No data
1103302543_1103302551 21 Left 1103302543 12:119939049-119939071 CCCACCACCATCTGTTTGTGGGA No data
Right 1103302551 12:119939093-119939115 GGACGGGTGATTTTGAAAGTAGG No data
1103302543_1103302552 27 Left 1103302543 12:119939049-119939071 CCCACCACCATCTGTTTGTGGGA No data
Right 1103302552 12:119939099-119939121 GTGATTTTGAAAGTAGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103302543 Original CRISPR TCCCACAAACAGATGGTGGT GGG (reversed) Intergenic
No off target data available for this crispr