ID: 1103302544

View in Genome Browser
Species Human (GRCh38)
Location 12:119939050-119939072
Sequence CTCCCACAAACAGATGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103302544_1103302548 -1 Left 1103302544 12:119939050-119939072 CCACCACCATCTGTTTGTGGGAG No data
Right 1103302548 12:119939072-119939094 GTATATATTGGCACAAATCTTGG No data
1103302544_1103302551 20 Left 1103302544 12:119939050-119939072 CCACCACCATCTGTTTGTGGGAG No data
Right 1103302551 12:119939093-119939115 GGACGGGTGATTTTGAAAGTAGG No data
1103302544_1103302552 26 Left 1103302544 12:119939050-119939072 CCACCACCATCTGTTTGTGGGAG No data
Right 1103302552 12:119939099-119939121 GTGATTTTGAAAGTAGGCTTTGG No data
1103302544_1103302550 4 Left 1103302544 12:119939050-119939072 CCACCACCATCTGTTTGTGGGAG No data
Right 1103302550 12:119939077-119939099 TATTGGCACAAATCTTGGACGGG No data
1103302544_1103302549 3 Left 1103302544 12:119939050-119939072 CCACCACCATCTGTTTGTGGGAG No data
Right 1103302549 12:119939076-119939098 ATATTGGCACAAATCTTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103302544 Original CRISPR CTCCCACAAACAGATGGTGG TGG (reversed) Intergenic
No off target data available for this crispr