ID: 1103302548

View in Genome Browser
Species Human (GRCh38)
Location 12:119939072-119939094
Sequence GTATATATTGGCACAAATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103302543_1103302548 0 Left 1103302543 12:119939049-119939071 CCCACCACCATCTGTTTGTGGGA No data
Right 1103302548 12:119939072-119939094 GTATATATTGGCACAAATCTTGG No data
1103302546_1103302548 -7 Left 1103302546 12:119939056-119939078 CCATCTGTTTGTGGGAGTATATA No data
Right 1103302548 12:119939072-119939094 GTATATATTGGCACAAATCTTGG No data
1103302545_1103302548 -4 Left 1103302545 12:119939053-119939075 CCACCATCTGTTTGTGGGAGTAT No data
Right 1103302548 12:119939072-119939094 GTATATATTGGCACAAATCTTGG No data
1103302544_1103302548 -1 Left 1103302544 12:119939050-119939072 CCACCACCATCTGTTTGTGGGAG No data
Right 1103302548 12:119939072-119939094 GTATATATTGGCACAAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103302548 Original CRISPR GTATATATTGGCACAAATCT TGG Intergenic
No off target data available for this crispr