ID: 1103302552 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:119939099-119939121 |
Sequence | GTGATTTTGAAAGTAGGCTT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1103302545_1103302552 | 23 | Left | 1103302545 | 12:119939053-119939075 | CCACCATCTGTTTGTGGGAGTAT | No data | ||
Right | 1103302552 | 12:119939099-119939121 | GTGATTTTGAAAGTAGGCTTTGG | No data | ||||
1103302546_1103302552 | 20 | Left | 1103302546 | 12:119939056-119939078 | CCATCTGTTTGTGGGAGTATATA | No data | ||
Right | 1103302552 | 12:119939099-119939121 | GTGATTTTGAAAGTAGGCTTTGG | No data | ||||
1103302543_1103302552 | 27 | Left | 1103302543 | 12:119939049-119939071 | CCCACCACCATCTGTTTGTGGGA | No data | ||
Right | 1103302552 | 12:119939099-119939121 | GTGATTTTGAAAGTAGGCTTTGG | No data | ||||
1103302544_1103302552 | 26 | Left | 1103302544 | 12:119939050-119939072 | CCACCACCATCTGTTTGTGGGAG | No data | ||
Right | 1103302552 | 12:119939099-119939121 | GTGATTTTGAAAGTAGGCTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1103302552 | Original CRISPR | GTGATTTTGAAAGTAGGCTT TGG | Intergenic | ||
No off target data available for this crispr |