ID: 1103303922

View in Genome Browser
Species Human (GRCh38)
Location 12:119949327-119949349
Sequence GTGTCACGTTTCTATTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103303916_1103303922 13 Left 1103303916 12:119949291-119949313 CCCAGTTTATTTAAGCACCACCT No data
Right 1103303922 12:119949327-119949349 GTGTCACGTTTCTATTTCACAGG No data
1103303917_1103303922 12 Left 1103303917 12:119949292-119949314 CCAGTTTATTTAAGCACCACCTG No data
Right 1103303922 12:119949327-119949349 GTGTCACGTTTCTATTTCACAGG No data
1103303919_1103303922 -4 Left 1103303919 12:119949308-119949330 CCACCTGGCAGCCGCTGAAGTGT No data
Right 1103303922 12:119949327-119949349 GTGTCACGTTTCTATTTCACAGG No data
1103303920_1103303922 -7 Left 1103303920 12:119949311-119949333 CCTGGCAGCCGCTGAAGTGTCAC No data
Right 1103303922 12:119949327-119949349 GTGTCACGTTTCTATTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103303922 Original CRISPR GTGTCACGTTTCTATTTCAC AGG Intergenic
No off target data available for this crispr