ID: 1103305739

View in Genome Browser
Species Human (GRCh38)
Location 12:119962593-119962615
Sequence GGGCCCACTGGACCCATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103305739_1103305745 26 Left 1103305739 12:119962593-119962615 CCTTCCATGGGTCCAGTGGGCCC No data
Right 1103305745 12:119962642-119962664 CAGAGTCTCGCTCTGTCACCTGG 0: 662
1: 3825
2: 9086
3: 13908
4: 14007
1103305739_1103305746 27 Left 1103305739 12:119962593-119962615 CCTTCCATGGGTCCAGTGGGCCC No data
Right 1103305746 12:119962643-119962665 AGAGTCTCGCTCTGTCACCTGGG 0: 253
1: 8816
2: 53957
3: 134444
4: 164240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103305739 Original CRISPR GGGCCCACTGGACCCATGGA AGG (reversed) Intergenic
No off target data available for this crispr