ID: 1103308656

View in Genome Browser
Species Human (GRCh38)
Location 12:119988007-119988029
Sequence CACCAACGAGGTCAACACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103308656 Original CRISPR CACCAACGAGGTCAACACCA AGG Intergenic