ID: 1103312772

View in Genome Browser
Species Human (GRCh38)
Location 12:120025137-120025159
Sequence AGAATGGTGTGAACCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2703
Summary {0: 18, 1: 377, 2: 450, 3: 646, 4: 1212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103312772_1103312783 12 Left 1103312772 12:120025137-120025159 CCCCCTGGGGTTCACACCATTCT 0: 18
1: 377
2: 450
3: 646
4: 1212
Right 1103312783 12:120025172-120025194 TCCCGAGTAGCTGGGACTACAGG 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
1103312772_1103312781 4 Left 1103312772 12:120025137-120025159 CCCCCTGGGGTTCACACCATTCT 0: 18
1: 377
2: 450
3: 646
4: 1212
Right 1103312781 12:120025164-120025186 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
1103312772_1103312779 3 Left 1103312772 12:120025137-120025159 CCCCCTGGGGTTCACACCATTCT 0: 18
1: 377
2: 450
3: 646
4: 1212
Right 1103312779 12:120025163-120025185 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103312772 Original CRISPR AGAATGGTGTGAACCCCAGG GGG (reversed) Intronic
Too many off-targets to display for this crispr