ID: 1103315987

View in Genome Browser
Species Human (GRCh38)
Location 12:120056288-120056310
Sequence ATAGGTGAATATAAAATAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 463}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103315987_1103315989 12 Left 1103315987 12:120056288-120056310 CCATCTATTTTATATTCACCTAT 0: 1
1: 0
2: 3
3: 32
4: 463
Right 1103315989 12:120056323-120056345 TTTTTGCCACAAGTAATTACTGG 0: 1
1: 0
2: 0
3: 12
4: 205
1103315987_1103315992 30 Left 1103315987 12:120056288-120056310 CCATCTATTTTATATTCACCTAT 0: 1
1: 0
2: 3
3: 32
4: 463
Right 1103315992 12:120056341-120056363 ACTGGCTGCTTAGTTAGGCATGG 0: 1
1: 0
2: 0
3: 9
4: 102
1103315987_1103315991 25 Left 1103315987 12:120056288-120056310 CCATCTATTTTATATTCACCTAT 0: 1
1: 0
2: 3
3: 32
4: 463
Right 1103315991 12:120056336-120056358 TAATTACTGGCTGCTTAGTTAGG 0: 1
1: 0
2: 1
3: 16
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103315987 Original CRISPR ATAGGTGAATATAAAATAGA TGG (reversed) Intronic