ID: 1103315987 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:120056288-120056310 |
Sequence | ATAGGTGAATATAAAATAGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 499 | |||
Summary | {0: 1, 1: 0, 2: 3, 3: 32, 4: 463} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1103315987_1103315989 | 12 | Left | 1103315987 | 12:120056288-120056310 | CCATCTATTTTATATTCACCTAT | 0: 1 1: 0 2: 3 3: 32 4: 463 |
||
Right | 1103315989 | 12:120056323-120056345 | TTTTTGCCACAAGTAATTACTGG | 0: 1 1: 0 2: 0 3: 12 4: 205 |
||||
1103315987_1103315992 | 30 | Left | 1103315987 | 12:120056288-120056310 | CCATCTATTTTATATTCACCTAT | 0: 1 1: 0 2: 3 3: 32 4: 463 |
||
Right | 1103315992 | 12:120056341-120056363 | ACTGGCTGCTTAGTTAGGCATGG | 0: 1 1: 0 2: 0 3: 9 4: 102 |
||||
1103315987_1103315991 | 25 | Left | 1103315987 | 12:120056288-120056310 | CCATCTATTTTATATTCACCTAT | 0: 1 1: 0 2: 3 3: 32 4: 463 |
||
Right | 1103315991 | 12:120056336-120056358 | TAATTACTGGCTGCTTAGTTAGG | 0: 1 1: 0 2: 1 3: 16 4: 123 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1103315987 | Original CRISPR | ATAGGTGAATATAAAATAGA TGG (reversed) | Intronic | ||