ID: 1103315988

View in Genome Browser
Species Human (GRCh38)
Location 12:120056306-120056328
Sequence CAAAAAACATTTGAAATCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 673
Summary {0: 1, 1: 0, 2: 8, 3: 41, 4: 623}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103315988_1103315989 -6 Left 1103315988 12:120056306-120056328 CCTATGATTTCAAATGTTTTTTG 0: 1
1: 0
2: 8
3: 41
4: 623
Right 1103315989 12:120056323-120056345 TTTTTGCCACAAGTAATTACTGG 0: 1
1: 0
2: 0
3: 12
4: 205
1103315988_1103315992 12 Left 1103315988 12:120056306-120056328 CCTATGATTTCAAATGTTTTTTG 0: 1
1: 0
2: 8
3: 41
4: 623
Right 1103315992 12:120056341-120056363 ACTGGCTGCTTAGTTAGGCATGG 0: 1
1: 0
2: 0
3: 9
4: 102
1103315988_1103315991 7 Left 1103315988 12:120056306-120056328 CCTATGATTTCAAATGTTTTTTG 0: 1
1: 0
2: 8
3: 41
4: 623
Right 1103315991 12:120056336-120056358 TAATTACTGGCTGCTTAGTTAGG 0: 1
1: 0
2: 1
3: 16
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103315988 Original CRISPR CAAAAAACATTTGAAATCAT AGG (reversed) Intronic