ID: 1103315991

View in Genome Browser
Species Human (GRCh38)
Location 12:120056336-120056358
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103315987_1103315991 25 Left 1103315987 12:120056288-120056310 CCATCTATTTTATATTCACCTAT 0: 1
1: 0
2: 3
3: 32
4: 463
Right 1103315991 12:120056336-120056358 TAATTACTGGCTGCTTAGTTAGG 0: 1
1: 0
2: 1
3: 16
4: 123
1103315988_1103315991 7 Left 1103315988 12:120056306-120056328 CCTATGATTTCAAATGTTTTTTG 0: 1
1: 0
2: 8
3: 41
4: 623
Right 1103315991 12:120056336-120056358 TAATTACTGGCTGCTTAGTTAGG 0: 1
1: 0
2: 1
3: 16
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type