ID: 1103316044

View in Genome Browser
Species Human (GRCh38)
Location 12:120056771-120056793
Sequence CCAGGTCTCCACATCCATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 188}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103316044_1103316050 -1 Left 1103316044 12:120056771-120056793 CCTAGATGGATGTGGAGACCTGG 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1103316050 12:120056793-120056815 GCAGGAGAGTGGCTGCAGCTGGG 0: 1
1: 0
2: 4
3: 132
4: 1912
1103316044_1103316053 14 Left 1103316044 12:120056771-120056793 CCTAGATGGATGTGGAGACCTGG 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1103316053 12:120056808-120056830 CAGCTGGGGAACCTGAGGCCAGG 0: 1
1: 13
2: 93
3: 483
4: 3133
1103316044_1103316052 9 Left 1103316044 12:120056771-120056793 CCTAGATGGATGTGGAGACCTGG 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1103316052 12:120056803-120056825 GGCTGCAGCTGGGGAACCTGAGG 0: 1
1: 0
2: 4
3: 87
4: 699
1103316044_1103316049 -2 Left 1103316044 12:120056771-120056793 CCTAGATGGATGTGGAGACCTGG 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1103316049 12:120056792-120056814 GGCAGGAGAGTGGCTGCAGCTGG 0: 1
1: 0
2: 11
3: 175
4: 1329
1103316044_1103316051 0 Left 1103316044 12:120056771-120056793 CCTAGATGGATGTGGAGACCTGG 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1103316051 12:120056794-120056816 CAGGAGAGTGGCTGCAGCTGGGG 0: 1
1: 0
2: 10
3: 81
4: 780

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103316044 Original CRISPR CCAGGTCTCCACATCCATCT AGG (reversed) Intronic
900851601 1:5147329-5147351 GCAGCTTTCCCCATCCATCTAGG - Intergenic
906225490 1:44118536-44118558 CCAGGTCTCCAACTCCAGCCAGG - Intergenic
911170911 1:94770039-94770061 CCAAGCCCCCACATTCATCTTGG + Intergenic
914429855 1:147611446-147611468 CCATGCCTCCACTTCCATCAGGG - Intronic
915029300 1:152862444-152862466 CCAGCTCTCCATGTTCATCTGGG + Intergenic
915165120 1:153944167-153944189 CCAGGGCTACACATGCATCCAGG - Exonic
915471733 1:156129845-156129867 CCAGGCCTCCAGGTCCATCTGGG - Intronic
915591536 1:156873886-156873908 CCAGGCCTCCGCCTCCATCATGG + Exonic
919205831 1:194420804-194420826 CCAGGTCTGCAGATGCAGCTGGG + Intergenic
920849023 1:209616033-209616055 CCAGGCCTACACATCCTTCCAGG + Intronic
924255399 1:242177859-242177881 CAAGGTCTACAAACCCATCTGGG + Intronic
924549600 1:245063196-245063218 CCAGGTCTCCACTTCACTCAGGG + Intronic
1064964449 10:21000929-21000951 CCAGCTCTCCAGCTCTATCTGGG - Intronic
1067842196 10:49689974-49689996 CCAGCGCTCCCCATCCCTCTCGG - Intronic
1068127431 10:52858206-52858228 TCAGGTCTTCATATCCATCCTGG + Intergenic
1068674535 10:59756857-59756879 ACAGGTTTCTACATCCATTTAGG - Intergenic
1070565374 10:77600107-77600129 CAAAGACTCCACATCCACCTTGG + Intronic
1071386259 10:85124273-85124295 CCAACTCCCCACATCTATCTAGG - Intergenic
1074572094 10:114633331-114633353 CCATTTCTTCACATTCATCTTGG + Intronic
1075708853 10:124519724-124519746 TGAGGTCTCCAACTCCATCTAGG + Intronic
1076485867 10:130816612-130816634 CCAGGTCTGCACAGACATCCTGG + Intergenic
1079112456 11:17612508-17612530 CCAGGCCTCTGCATCCATCCAGG + Intronic
1083255824 11:61494902-61494924 CCAAGTCTCCACCTCTGTCTTGG - Intergenic
1083417271 11:62533817-62533839 CTGGGTCTCCACATCCACATTGG + Exonic
1083617564 11:64034204-64034226 CCAGGGCCACACGTCCATCTGGG + Intronic
1085397021 11:76211554-76211576 CCATGTCTCCCCCTCCTTCTAGG + Intergenic
1085516691 11:77115906-77115928 CCTGGGCTCCACTCCCATCTTGG - Intronic
1085534477 11:77209756-77209778 CCTGTTCTCCTCATCCATTTTGG + Intronic
1086218162 11:84408017-84408039 CTAGTTCTTCACATACATCTAGG - Intronic
1087084197 11:94199886-94199908 CCAGCTTGCCACCTCCATCTGGG + Intergenic
1088031500 11:105256788-105256810 CCAAGTCTCCACATTCTTCAGGG - Intergenic
1089332319 11:117698541-117698563 CAATTTCTCCACATCCACCTGGG + Intronic
1090828777 11:130406418-130406440 GCAGCTTTCCACATCCTTCTGGG - Intronic
1090868217 11:130720759-130720781 CCAGGTCTCCTCAGTCATCGTGG - Intergenic
1092833030 12:12463721-12463743 ACATGTTTCCACATCCAGCTGGG - Intronic
1099848272 12:88057691-88057713 CCAGGACTTCATGTCCATCTGGG + Intronic
1101964652 12:109274223-109274245 CTAGCTCTCCAGATCCATCTGGG - Intergenic
1102601445 12:114033760-114033782 CAAGGACTCCCTATCCATCTTGG - Intergenic
1102644191 12:114393283-114393305 CACCATCTCCACATCCATCTAGG + Intronic
1103123151 12:118397601-118397623 GCATGTCTCCATCTCCATCTAGG - Intronic
1103316044 12:120056771-120056793 CCAGGTCTCCACATCCATCTAGG - Intronic
1104185904 12:126431021-126431043 CCAGTTCTGCTCCTCCATCTTGG + Intergenic
1104616621 12:130275773-130275795 CAAGTTCTCCCCATCCTTCTTGG + Intergenic
1105706505 13:22970829-22970851 CCAGGTCTGCCCATCCACCTCGG + Intergenic
1111760293 13:92455131-92455153 CCAGGACTCCACATTCAGATAGG + Intronic
1115831037 14:37341652-37341674 CCAGGTATCCAAAACCAGCTTGG - Intronic
1118740840 14:68738161-68738183 CCAGGAAGTCACATCCATCTGGG + Intergenic
1118743189 14:68756082-68756104 CCACGCCTCCCCAACCATCTGGG + Intergenic
1119183232 14:72618420-72618442 CCAGGTCTCCAGAACCAGGTGGG + Intergenic
1119793796 14:77377451-77377473 CCAGCTCTCCATCTTCATCTGGG - Exonic
1121045036 14:90781674-90781696 CCTGATCTTCACATCCATTTGGG - Intronic
1121562155 14:94883966-94883988 CCAGGGCACCTCCTCCATCTCGG - Intergenic
1122411579 14:101528610-101528632 CCAAGTCTCCACATCCCTGTGGG - Intergenic
1122942843 14:104990170-104990192 CCAGGACTCCCCATGCCTCTGGG - Intronic
1123064302 14:105608695-105608717 CCAGGTCATCCCATCCATCGAGG + Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1128495757 15:68197611-68197633 CCAGCTCTCCATTTCCGTCTAGG + Exonic
1128671608 15:69578111-69578133 CCAGCCCTCCACCCCCATCTAGG - Intergenic
1129155312 15:73713923-73713945 CAAGGACTCCCCATCCAGCTGGG + Exonic
1129185659 15:73904651-73904673 CCCTGGCTCCACATCTATCTTGG - Intergenic
1129270753 15:74418146-74418168 CCACGTCTCCCCATCAGTCTGGG + Intronic
1130399616 15:83537245-83537267 TCAGATCTCCACATCCACTTTGG + Intronic
1132720535 16:1313594-1313616 CCAGCACCCCACATCCATCTGGG + Intronic
1135114670 16:19714540-19714562 CCAGGACCCCACAGCCTTCTCGG - Exonic
1138424178 16:56919550-56919572 TCTGGTCTCCCCATCCAACTGGG - Intergenic
1138803458 16:60063657-60063679 CCAGGACTCCACTTCCATCCAGG + Intergenic
1139556115 16:67711916-67711938 TCAGGTCTCTACTTCCATGTTGG + Intronic
1140429494 16:74889723-74889745 CCTGGGCTCGACATCCATTTGGG - Exonic
1141351919 16:83306053-83306075 ACAGGTATCTACACCCATCTAGG - Intronic
1142003987 16:87680378-87680400 CCAGGGCTCCGCTTCCTTCTGGG - Intronic
1142978839 17:3660052-3660074 CCAGGGCTCCACCCCCACCTGGG + Intronic
1143504500 17:7356273-7356295 CCAGGTCCTCACGCCCATCTTGG + Exonic
1147120107 17:38330742-38330764 CCAGGTTTCTACCCCCATCTTGG - Exonic
1147614964 17:41822219-41822241 CCAGTTCTCCACCTTCATCAAGG + Exonic
1148876456 17:50690208-50690230 CCTGTTCTCCACCCCCATCTTGG - Intronic
1149434767 17:56624013-56624035 ACAGGAATCCACATCCATCCTGG + Intergenic
1150645458 17:66975013-66975035 CCACGTCACCACATCCAACACGG + Intronic
1155846544 18:30715054-30715076 CCAGGCCTCCACATTCACTTGGG - Intergenic
1157110213 18:44813577-44813599 CCAGCTCCCCAATTCCATCTAGG + Intronic
1157922130 18:51723992-51724014 CCAGGTATATGCATCCATCTTGG - Intergenic
1159500037 18:69256941-69256963 CCAGGTCACCAAATCCAACAAGG + Intergenic
1160843419 19:1156331-1156353 CCAGGTCTCCACACCCTGCCAGG - Intronic
1163797721 19:19346909-19346931 CCAGGTGTCCACTGCCATCAAGG - Intronic
1164417614 19:28059679-28059701 CCAGGTGTTCATAGCCATCTAGG - Intergenic
1164676910 19:30107147-30107169 CCAGGTGTCCGCGTCCACCTGGG - Intergenic
1164868418 19:31624197-31624219 TCAGGTCTCCACATCCTTTGGGG + Intergenic
1165324241 19:35104869-35104891 GCAGTTCTCCACATGCACCTGGG - Intergenic
1165938976 19:39405776-39405798 CCAGGTCTCCTTATCTGTCTGGG + Intergenic
1166518348 19:43463525-43463547 CCACGGCTCCACCTCTATCTTGG + Intronic
1167534612 19:50041758-50041780 CCAGATCTTCACTGCCATCTGGG - Exonic
1168642006 19:58037058-58037080 CCTGGTCTCCACCCCCAGCTTGG + Intronic
925202488 2:1979760-1979782 CTCGGTGTCCACCTCCATCTGGG + Exonic
925601418 2:5612022-5612044 CCAGGTGTCCTCTGCCATCTTGG - Intergenic
928841560 2:35611699-35611721 CCGGGTCTCCACCTCCTCCTTGG - Intergenic
933739826 2:85524718-85524740 CCAGCACTCCACAGCCTTCTAGG + Intergenic
933992714 2:87645061-87645083 CCCTGTATCCACATCCATCCAGG + Intergenic
935210987 2:100939111-100939133 CCAGGGCTCCACATCATCCTGGG + Intronic
936258027 2:110934212-110934234 GCAGGTCTCCACACCCATGCGGG + Intronic
936301142 2:111305780-111305802 CCCTGTATCCACATCCATCCAGG - Intergenic
936677082 2:114728134-114728156 ACAGGTCTCCACAGACTTCTTGG + Intronic
937303211 2:120855974-120855996 CCAGGTCCCCAGATCCAAGTAGG - Intronic
938298607 2:130194295-130194317 CCAGGTCTCCACAGCCGTGGTGG - Exonic
938458124 2:131480218-131480240 CCAGGTCTCCACAGCCGTGGTGG + Exonic
941702883 2:168623840-168623862 CCAGGTCTCCATCGACATCTTGG - Intronic
941829988 2:169945455-169945477 CCAAGTCCCCTCAGCCATCTGGG + Intronic
946859077 2:223983157-223983179 AAAGTTCTCCATATCCATCTTGG + Intronic
948749340 2:240121917-240121939 CCAGCGCGCCACGTCCATCTTGG + Intergenic
1168903561 20:1386419-1386441 CAAGGTCTCCCCATCAGTCTTGG - Intronic
1172175542 20:32969959-32969981 CCTGGTCTCCAAAAGCATCTGGG + Intergenic
1173180766 20:40804722-40804744 CCAGGACTCCATCTCAATCTGGG + Intergenic
1175970755 20:62685523-62685545 CCGAGACTCCACATCCATCACGG - Intronic
1176312295 21:5158583-5158605 CCAGGTCTTCAACTCCAGCTCGG - Intergenic
1178498723 21:33108876-33108898 CCAGCTCTCCACAGCCAGCCTGG - Intergenic
1179598550 21:42460412-42460434 CCAGTTCTCCACTTCCCTCCTGG + Intergenic
1179622578 21:42626993-42627015 CCAGGACTTCCCATGCATCTGGG - Intergenic
1179844753 21:44103447-44103469 CCAGGTCTTCAACTCCAGCTCGG + Exonic
1179879254 21:44286628-44286650 CCAGGACTCCACAGCCATCCTGG + Exonic
1181984854 22:26793106-26793128 CCTGGGCCCCACATCCATCATGG - Intergenic
1182076496 22:27498995-27499017 CCAGGGCTCCACAGGCTTCTGGG - Intergenic
1183355874 22:37359138-37359160 CCAGGTCTCCATCTCTCTCTTGG - Intergenic
1183507945 22:38219853-38219875 CCAGCTCTCCCCCTCCATCTTGG - Exonic
1183775361 22:39960548-39960570 CCACTTGTCCAGATCCATCTGGG + Intronic
1184332567 22:43835416-43835438 CCAGCGCTCCTCATCCAGCTGGG - Intronic
1185204058 22:49527053-49527075 CCAGGTCTCCTCAGCCACATGGG - Intronic
949775557 3:7628787-7628809 CCAGGTCTCAGCAGCCATATTGG + Intronic
950415571 3:12867270-12867292 CCAGGCCTTCACAACCTTCTAGG - Intronic
950572309 3:13809057-13809079 CCAGGGCCACACATCCATCAGGG - Intergenic
956319176 3:67976425-67976447 CTAGTTCTCCACTTCCATTTTGG + Intergenic
957847056 3:85751583-85751605 GCACGTCTTCACATCCATTTAGG + Intronic
959956597 3:112245797-112245819 CCAAGTCTTCAAATCCATATTGG + Intronic
962317444 3:134367619-134367641 CCAGGCCTCCTCAGCCACCTCGG - Exonic
962921508 3:139954355-139954377 ACTTGTCTTCACATCCATCTGGG + Intronic
964882871 3:161443633-161443655 CCAGCTCTCCCCATCCATGTTGG - Intergenic
965621141 3:170643372-170643394 CCAGGCCACCACAGCCAGCTGGG + Intronic
971046172 4:22807444-22807466 CAAAGTTTCCACCTCCATCTCGG + Intergenic
972205204 4:36763416-36763438 TCAGGCCTCCTCATCTATCTTGG + Intergenic
975921671 4:79398185-79398207 CCAGGTCCCCAGATTCATCTTGG - Intergenic
977284076 4:95080376-95080398 ACAGGTGTCCACAACCATGTCGG + Intronic
984937480 4:184901740-184901762 CCAGTTCTCCACATGCACCATGG - Intergenic
985889839 5:2706580-2706602 CCCTGTCTCCACACCCCTCTGGG - Intergenic
986703858 5:10439173-10439195 CCAGTTGTCCACATACATGTTGG - Exonic
997262851 5:132477394-132477416 TGAGGTCTTCACATCCATTTCGG - Intergenic
998146429 5:139731690-139731712 CCAGGTCTCCATGTCCCTCCAGG - Intergenic
1000546866 5:162613763-162613785 TCAGGACTCCACATACACCTAGG + Intergenic
1001663287 5:173412649-173412671 GCAGCTCTCCAGACCCATCTTGG - Intergenic
1004672556 6:17811317-17811339 CCAGGTGACCACATCATTCTAGG + Intronic
1004707612 6:18139168-18139190 CCAGGTCCACACATTCCTCTAGG - Intronic
1005469468 6:26147925-26147947 CATGGTCTCCACGTGCATCTTGG + Intergenic
1006049637 6:31331828-31331850 CCTGGTCTCCACCTTCATCAGGG - Intronic
1006936554 6:37722858-37722880 CTAGTACTCCACATCCATGTCGG + Intergenic
1009061227 6:58400010-58400032 TCAGGTTTCCACATGCACCTGGG - Intergenic
1009814944 6:68720983-68721005 CTATTTCTCCACATCCATTTAGG - Intronic
1010873354 6:81069531-81069553 CCATGTCCCTACATCCATGTAGG + Intergenic
1013292962 6:108734459-108734481 TCAGGTCTCCATAGCCACCTGGG - Intergenic
1013717877 6:112985306-112985328 CCAGTCCTCCTCAGCCATCTGGG - Intergenic
1014915487 6:127142254-127142276 CTAGGTCTCCACAACCATTTAGG - Intronic
1014971674 6:127824120-127824142 CCAGGTCTCCACTCTAATCTAGG + Intronic
1018698970 6:166412295-166412317 CCAGGTCACCCCAGCCCTCTGGG + Exonic
1018975137 6:168558672-168558694 CCAGGTGTGCACATCGAGCTTGG + Intronic
1019527653 7:1487912-1487934 CCGGGTCTCCTCATCCGTCAGGG + Exonic
1020745332 7:12072408-12072430 CCAAGTCTCCAGAACCAACTTGG - Intergenic
1022483400 7:30759090-30759112 CCAGGTCTCCCCACCCGGCTTGG + Intronic
1022816943 7:33923024-33923046 CCAAGACCCCACAACCATCTTGG - Intronic
1023845388 7:44117329-44117351 CCAGTTCTCCACAACCACATTGG + Intronic
1026621677 7:71955084-71955106 CGAGGTCTCCCCAGCCATGTGGG - Intronic
1026739553 7:72970028-72970050 CTAGGTCTCCAGCTCCTTCTCGG - Intergenic
1026790572 7:73328646-73328668 CTAGGTCTCCAGCTCCTTCTCGG - Exonic
1027104179 7:75395042-75395064 CTAGGTCTCCAGCTCCTTCTCGG + Intronic
1027495779 7:78886505-78886527 CCATGTCTCCACAAATATCTAGG + Intronic
1028105236 7:86868846-86868868 CCAGGTCTACTCATTCTTCTTGG + Intergenic
1030658758 7:112196603-112196625 CCAGGTCAATACATCCAACTTGG - Intronic
1031389133 7:121191543-121191565 TCAGTTCTCCAGATCCTTCTGGG + Intronic
1031696286 7:124859077-124859099 CCAGGACACCATTTCCATCTTGG - Exonic
1032453087 7:132051519-132051541 CCAGCTCTTCCCACCCATCTGGG - Intergenic
1032505878 7:132434324-132434346 CCAGCTCACCTTATCCATCTTGG + Intronic
1033438774 7:141359599-141359621 CCATTTCTCCAGGTCCATCTTGG + Intronic
1034443685 7:151101095-151101117 TCAGGGCTCAACATCCATCAGGG - Intronic
1035464088 7:159063908-159063930 CCAGGACCCCACATCCCTCCAGG - Intronic
1035540294 8:429875-429897 CCAGGGAGCCACAGCCATCTAGG + Intronic
1035626176 8:1072259-1072281 CCAGCTTTCCACTTCCATCGGGG + Intergenic
1036950892 8:13138196-13138218 CCAGTTCTCAACATCCCACTAGG - Intronic
1037753037 8:21695118-21695140 CCAGGTGTGCACATCCGTGTAGG - Intronic
1039463141 8:37762651-37762673 CCAGCTCTCCACATCCCCCGGGG - Exonic
1042211874 8:66389395-66389417 CCTGGTCTCCACTTCCAAGTTGG + Intergenic
1042957124 8:74262761-74262783 CCAGGTCTCCCCAGCCAGCATGG - Intronic
1044579332 8:93807927-93807949 CCAGATATCCATATCCATTTTGG - Intronic
1046873353 8:119227707-119227729 CCATTTCTCCATATACATCTGGG + Intronic
1048119553 8:131563988-131564010 CCAGGGCTGCACATCCCCCTAGG - Intergenic
1049233533 8:141496470-141496492 CCCTGTCTCCACATCCATGAAGG - Intergenic
1056621219 9:88216648-88216670 CCAGGTCTCCCTATCCATTCCGG - Intergenic
1059558039 9:115301034-115301056 CCAGATTTCCACATCCCTTTTGG - Intronic
1059958254 9:119540899-119540921 CCAGGCCCCCACATACTTCTGGG + Intergenic
1060470373 9:123943279-123943301 CCAGGTCTGCACCTCTGTCTAGG - Intergenic
1060624962 9:125103338-125103360 CCAGGACTCCAAATACACCTAGG + Intronic
1060941443 9:127545263-127545285 CCAGGTCTCCACAGCCTCCCTGG + Intronic
1061053513 9:128209623-128209645 CCACGCCTCCACATCCACCACGG - Intronic
1062065061 9:134522241-134522263 CCAGGTCTCCACCTCTGTCTGGG + Intergenic
1062217326 9:135396285-135396307 CCAGGTGTCCACAGGCTTCTGGG - Intergenic
1187884030 X:23872128-23872150 CCAGCTCACCAGAGCCATCTGGG - Intronic
1195688201 X:107603845-107603867 CCAGATGTCCCCATCCACCTTGG + Exonic
1201710174 Y:16982691-16982713 ACTGGTCTCCACCTGCATCTAGG + Intergenic