ID: 1103316797

View in Genome Browser
Species Human (GRCh38)
Location 12:120062711-120062733
Sequence CATTCCAAGGGAAAGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 341}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103316797_1103316808 30 Left 1103316797 12:120062711-120062733 CCTTCCCCCTTTCCCTTGGAATG 0: 1
1: 0
2: 6
3: 36
4: 341
Right 1103316808 12:120062764-120062786 GTAAGTAGAGTTTGTTCCAGTGG 0: 1
1: 0
2: 2
3: 8
4: 119
1103316797_1103316805 -1 Left 1103316797 12:120062711-120062733 CCTTCCCCCTTTCCCTTGGAATG 0: 1
1: 0
2: 6
3: 36
4: 341
Right 1103316805 12:120062733-120062755 GCCTACTGGTATTGAGCAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103316797 Original CRISPR CATTCCAAGGGAAAGGGGGA AGG (reversed) Intronic
900462399 1:2807937-2807959 AATACCATGGGAAAGGAGGACGG - Intergenic
900615121 1:3562051-3562073 CAAACCAAGGGTAAGGGGTAGGG + Intronic
904942951 1:34177576-34177598 TCTTCTAAGGGAGAGGGGGAGGG + Intronic
904959609 1:34322008-34322030 CATTTCAGGAGATAGGGGGATGG - Intergenic
905356620 1:37389266-37389288 CATTCAGAGGGAGAGTGGGAAGG - Intergenic
906588936 1:47005257-47005279 CATTGAATGGGAAAGTGGGATGG + Intergenic
908133206 1:61098020-61098042 CATTCCAAATGAATGAGGGATGG + Intronic
908757853 1:67485479-67485501 CCTTCAAAGGGAAAGGTGTAGGG + Intergenic
909031753 1:70549349-70549371 CATTCCAAGGTACAGGGGCTAGG + Intergenic
909789738 1:79660593-79660615 CAATCCAAGGGAATAGAGGAAGG - Intergenic
910524374 1:88161168-88161190 GAATCCAAGCCAAAGGGGGATGG - Intergenic
910694671 1:89999326-89999348 TTTTACAAGGGAGAGGGGGAGGG + Intronic
910712650 1:90197557-90197579 CCTTCCATGGGGAAGGGGGATGG + Intergenic
910979759 1:92948225-92948247 CATTCCAAGGCAAAGAGGAAAGG + Intronic
910979958 1:92950222-92950244 CATTCTAAGGCAAAGAGGAAAGG + Intronic
911743362 1:101411535-101411557 CATCCCTAGGAAAAAGGGGATGG + Intergenic
911965213 1:104360166-104360188 CTTTCCTAAGGAAAAGGGGAAGG + Intergenic
912413246 1:109491920-109491942 CAGCCCAAGGGAAAGGGTTAGGG - Intronic
912489082 1:110051552-110051574 CAGTCCAAGGGAAACTGGGATGG + Intronic
913049933 1:115108743-115108765 GATTCCAAAGGAAAGGTGGGAGG - Intergenic
913106343 1:115617172-115617194 CATTTGCAGGGGAAGGGGGATGG + Intergenic
913369102 1:118077277-118077299 CATTCCATTTGAAAGGGGGAGGG - Intronic
915135818 1:153730705-153730727 GTTTCCAGGGAAAAGGGGGAGGG + Intronic
915180761 1:154057394-154057416 AATTTCAAGGGAACGGTGGAAGG + Intronic
915519176 1:156431241-156431263 CAATTCCAGGGAAAGGAGGAAGG + Intergenic
916141929 1:161707296-161707318 CACACCAAGGGAAAGGTAGAGGG - Exonic
916879094 1:169001490-169001512 CATACAAAGGGAAGCGGGGAAGG - Intergenic
916900776 1:169220385-169220407 CAATCCCAGGAAAAGTGGGATGG - Intronic
918045445 1:180938464-180938486 CATTCCCAGCAACAGGGGGAGGG - Intronic
918171859 1:182004826-182004848 CACCCCTAGGGGAAGGGGGAGGG + Intergenic
920297341 1:204967118-204967140 CAGGACAAGGGAAAGGTGGAGGG - Intronic
920681554 1:208077002-208077024 CTTTCACAGGGAAAGGAGGATGG + Intronic
921187236 1:212680671-212680693 CTTTCCAAGGGAGAGGGAGGAGG + Intergenic
922279475 1:224109717-224109739 CATGCCAAGTGAATGGGGAAAGG + Intergenic
922801539 1:228366897-228366919 CAGTCCAGGGGAAAGGGGGCTGG - Intronic
923676944 1:236088446-236088468 AATTGCAAGGGATGGGGGGAAGG - Intergenic
924767999 1:247052298-247052320 CATCCCTAGGGAAACGGGGAGGG - Intronic
924770209 1:247073382-247073404 CATTCCTAGGGAATGAGTGAAGG + Intronic
924770224 1:247073452-247073474 CATTCCTAGGGAATGAGTGAAGG + Intronic
1063113393 10:3055549-3055571 CATCCCACGGGAAGGTGGGAGGG + Intergenic
1063306982 10:4911353-4911375 CATGCCATGTGCAAGGGGGAGGG + Intergenic
1063307465 10:4918364-4918386 CATGCCATGTGCAAGGGGGAGGG - Intergenic
1063523759 10:6764283-6764305 CACTCCAAAGGAAATGAGGAAGG - Intergenic
1065263776 10:23954266-23954288 CAATGAAAGGGAAAGGGGGCCGG + Intronic
1065455780 10:25905282-25905304 CAAGCCAAGGAAAAGGGGAATGG - Intergenic
1065544837 10:26808813-26808835 GATTCCAGAAGAAAGGGGGAGGG + Intronic
1065583238 10:27192574-27192596 CGCTCCAAGGGAAGAGGGGAGGG + Intergenic
1067018506 10:42775335-42775357 CTTTCCAAGAGGAAGAGGGAAGG + Intergenic
1068871838 10:61953836-61953858 CTTTCTAAAGGAAAGGGGAAAGG - Intronic
1069679739 10:70275440-70275462 CTTTCCAAGAGAAAGAGAGAGGG - Intronic
1070646398 10:78205048-78205070 CTTTCCTAGGGGAAGGAGGAAGG - Intergenic
1070702774 10:78615584-78615606 AATTCCCAGGCCAAGGGGGAAGG + Intergenic
1070760084 10:79018688-79018710 CCTTCCAAGGGGAATGGGGTGGG + Intergenic
1071467513 10:85955165-85955187 CCATCCAAGGGACAGGGAGATGG - Intronic
1073348273 10:102800856-102800878 CTTTCCAAAGGAAGGTGGGAAGG - Intronic
1074093514 10:110286398-110286420 CCTTCCCAGGGTAAGGGAGAGGG - Exonic
1074418745 10:113290429-113290451 CATTTCAAGGGAAAGCAGGCAGG - Intergenic
1074425375 10:113346706-113346728 CTCTCCAAGGGAAGGGTGGAAGG - Intergenic
1074501499 10:114028979-114029001 CATTGCAAGGGGCTGGGGGAAGG - Intergenic
1075746095 10:124728727-124728749 CATTCAAAGGGAAAGCTTGATGG + Intronic
1076850921 10:133092531-133092553 TGTTCCAGGGGAAAGGTGGAAGG - Intronic
1077551968 11:3204444-3204466 CATTCCAGGTGCAAGGGAGAGGG - Intergenic
1079075483 11:17383022-17383044 CAAACCAAGGGAAAGAGGGAAGG - Intergenic
1080268140 11:30422923-30422945 AATTTCAAGAGCAAGGGGGAGGG - Intronic
1081091038 11:38866933-38866955 CATACCTAGGGGAAGGGGGAGGG - Intergenic
1081547851 11:44084428-44084450 CTTTCAAAGGGAGAGGGAGAAGG - Intergenic
1082113041 11:48298338-48298360 CATCCCTAGGGTAAGGGGGAGGG - Intergenic
1083355799 11:62065143-62065165 CCTTCCCAGGCAAAGGAGGAAGG - Intergenic
1085665958 11:78416605-78416627 CATTTCATGGGAAACGGAGAGGG + Intronic
1087343057 11:96933693-96933715 AATTCTCAGGGAAAGCGGGATGG - Intergenic
1087820285 11:102704042-102704064 CATCTCAAGGAAAAGGGGGCAGG - Intronic
1088552168 11:111024294-111024316 CATTCAAAGGAAGAGGGTGATGG - Intergenic
1089070968 11:115699422-115699444 CATGCCCAGGGGAAGGGGCATGG - Intergenic
1090253035 11:125264332-125264354 CATTCCAAGGGATCTGGGGAAGG - Intronic
1090753112 11:129764428-129764450 CATCCCTAGGAAAAGGCGGAGGG + Intergenic
1090801421 11:130174916-130174938 CATACCAAGAGAAAGGGGATAGG - Intronic
1090848696 11:130551554-130551576 AAGGCCAAGGGAAAGGGGAAGGG + Intergenic
1092299322 12:7230480-7230502 CAGTCCCAGGGAAAGGCAGATGG - Intergenic
1093010602 12:14102445-14102467 CATCCATAGGAAAAGGGGGAGGG + Intergenic
1093172662 12:15876479-15876501 CATCCATAGGAAAAGGGGGAGGG + Intronic
1095227387 12:39694376-39694398 CACTCCCAGGGAATGGAGGAAGG - Intronic
1095810388 12:46368356-46368378 CAATCCAAGTGAAAGGGTCAAGG - Intronic
1096000669 12:48127290-48127312 AATTATAAGGGAAAGGGGCAAGG - Intronic
1099181029 12:79472868-79472890 AATTCCAGGGGAAAAGAGGATGG + Intergenic
1099290012 12:80764877-80764899 CATTCTAAGGGAAAGTATGAAGG - Intergenic
1099803538 12:87488200-87488222 CATGCCTAGGAAAACGGGGAAGG - Intergenic
1100255527 12:92879529-92879551 CATTCAAAGGGAAGGGGGAGGGG + Intronic
1102563248 12:113777697-113777719 GCTTCCAGGGAAAAGGGGGAGGG + Intergenic
1102645005 12:114398114-114398136 CATCCCTAGGCAAAGGGAGAGGG + Intronic
1103068428 12:117919402-117919424 CATTCCAAGGAATAAGTGGAGGG + Intronic
1103244781 12:119447308-119447330 CAGTACAAGGGGAAGTGGGAGGG - Intronic
1103316797 12:120062711-120062733 CATTCCAAGGGAAAGGGGGAAGG - Intronic
1103526120 12:121569778-121569800 AATACCAAGGGAGAGGGGGCTGG + Intronic
1103550321 12:121732402-121732424 CATTTCAGGGGTAAAGGGGAGGG - Intronic
1104711470 12:130989842-130989864 CATTCCAGTGGTAAGGGAGAGGG - Intronic
1105384911 13:19920658-19920680 CATGCCTAGGGAAAGAGGAAGGG + Intergenic
1106065586 13:26345191-26345213 CATTCCAAGGTACTGGGGGTAGG + Intronic
1106248048 13:27965336-27965358 GACACCAAGGGAAAGGGGGCAGG + Intronic
1106911594 13:34468894-34468916 AATGCCAAAGGAAAGGGGAAAGG - Intergenic
1107884830 13:44866537-44866559 CCTACCAAAGGAAAGGGGCAAGG + Intergenic
1107986115 13:45777784-45777806 ATTTCTAAGGGAAAGGGGAAGGG - Exonic
1108273177 13:48783091-48783113 CATTCCTAGGGGAAGGGGGAGGG - Intergenic
1110019931 13:70457461-70457483 CATTCCTCTGGAAAGGGGGCTGG + Intergenic
1110665268 13:78109561-78109583 CAGTACAGGGGAATGGGGGATGG - Intergenic
1112575877 13:100636282-100636304 ACTTCCTAGGGAAAGGGGAAGGG + Intronic
1113564319 13:111309644-111309666 CAAGGCAAGGAAAAGGGGGAGGG + Intergenic
1114267131 14:21079434-21079456 CCTTCCAAGGGAGAGGGAGGTGG - Intronic
1114550186 14:23528294-23528316 CAATCCAAGGGAAAGTGGGGAGG - Intronic
1115776104 14:36716916-36716938 CATTCCTATGGAAAGGTGAACGG + Intronic
1115785252 14:36818213-36818235 CAATGGAAGGGAAAGGGAGAGGG + Intronic
1116798600 14:49418332-49418354 CCTTCCCAGGGGAAGGGGGTTGG + Intergenic
1117240794 14:53830138-53830160 CATCCCTAGGGGAAAGGGGAGGG + Intergenic
1117509134 14:56431249-56431271 CATTGCAAGGGAAAAGGAGCAGG - Intergenic
1117691889 14:58316531-58316553 CATTTCAAGGAAATGGGGTAAGG - Intronic
1119201217 14:72754210-72754232 TATTCCCAGGGAAATGGGGCGGG + Intronic
1122032562 14:98924178-98924200 CATTCCAAGGGACAGGTGGGGGG - Intergenic
1122478473 14:102029080-102029102 CATTCCAAGGGCAATGGAGATGG - Intronic
1122710097 14:103650188-103650210 CAGTCAGAGGGAAAGAGGGAAGG + Intronic
1122787587 14:104171115-104171137 CATTCGAATGCAAACGGGGACGG - Intronic
1122860483 14:104580270-104580292 CAGTCCCAGGAGAAGGGGGAAGG - Intronic
1124012885 15:25852809-25852831 CTTCTCAAGGGAAAGGGAGATGG - Intronic
1126536122 15:49767368-49767390 CTCTCCATGGGAAAGGGGGTAGG + Intergenic
1126866820 15:52945731-52945753 CATCCCAAGAGACAGGGGGATGG - Intergenic
1127149185 15:56055926-56055948 AAATTCAAGGGAAAGGGAGATGG + Intergenic
1127536046 15:59890777-59890799 CAAGCCCAGGGAAAGGTGGATGG + Intergenic
1127763388 15:62163645-62163667 CATTCCAAGGAAAAATGGGTTGG - Exonic
1127983261 15:64049655-64049677 CATTCCAAGGGACTGTGAGATGG + Intronic
1128346334 15:66854738-66854760 CATTCACTGGGGAAGGGGGAGGG + Intergenic
1128458575 15:67848466-67848488 CACTTCAAGGGAGAGAGGGAAGG + Intergenic
1131459076 15:92605792-92605814 CATTCCAGTGGCAAGGGGGCAGG + Intergenic
1131569148 15:93515914-93515936 CCTTCCAAGGGCCAGGAGGAAGG - Intergenic
1132626523 16:894167-894189 CAGTCCAGTGGACAGGGGGACGG - Intronic
1132626534 16:894199-894221 CAGTCCAGTGGACAGGGGGACGG - Intronic
1134429279 16:14186605-14186627 AATGGCAAGGGAAAGGGGGCTGG + Intronic
1140224015 16:73064478-73064500 CATCCCTGGGGCAAGGGGGAGGG + Intergenic
1140946272 16:79770871-79770893 GTTGCAAAGGGAAAGGGGGAGGG - Intergenic
1144333272 17:14244277-14244299 TATTTGGAGGGAAAGGGGGATGG - Intergenic
1146528610 17:33588694-33588716 CAGTCCAAGGCAGAGAGGGAAGG + Intronic
1147141520 17:38463232-38463254 CATCCCCAGGGCAAAGGGGAGGG - Intronic
1147323394 17:39659123-39659145 CATTCCAAGGGCAGGGGTTAGGG - Intronic
1148408839 17:47446939-47446961 CATTCTAATGGATTGGGGGAAGG - Intergenic
1148564497 17:48625259-48625281 CCGGCCAAGGGGAAGGGGGAGGG - Intronic
1148908216 17:50925089-50925111 AATTCCAAGGGGAAATGGGAAGG + Intergenic
1149478294 17:56981998-56982020 CACACTCAGGGAAAGGGGGAAGG - Intronic
1149575533 17:57709172-57709194 GATTACCAGGGAATGGGGGAAGG - Intergenic
1150129964 17:62663765-62663787 CAGTGCAAGGGGCAGGGGGAAGG + Intronic
1150680424 17:67280055-67280077 CTTTCCAGGGAAAAGGGGGAGGG - Intergenic
1151331071 17:73409044-73409066 TGTTCCAAGGGAAAGGCAGAGGG + Intronic
1151435253 17:74091619-74091641 CATCCCATGGCAAAAGGGGAAGG + Intergenic
1151561343 17:74871541-74871563 CCTTCACAGGGGAAGGGGGAGGG + Intronic
1152750537 17:82060565-82060587 CTGCCCAAGGGAAAGGAGGAGGG - Intronic
1153284741 18:3447860-3447882 CTTTCCAGGAGAAGGGGGGAGGG - Intronic
1153448012 18:5195937-5195959 CATTCTGAGGGGGAGGGGGAGGG + Intronic
1153912085 18:9713293-9713315 CATTTCTTGGGGAAGGGGGATGG + Intronic
1153960503 18:10136099-10136121 GCTTCAAAGGGAAAGGAGGATGG + Intergenic
1156474707 18:37398186-37398208 TATTGAAAGGGAATGGGGGAAGG - Intronic
1157187809 18:45555229-45555251 AATTCCAAGGGGAGGGGAGAAGG + Intronic
1158197672 18:54906623-54906645 CATTCTAAGGGAAGGAAGGATGG - Intronic
1158233842 18:55290177-55290199 AATTCAAAGGGAAAAGGGTAGGG - Intronic
1158385715 18:56988840-56988862 TAGACCAAGGGAGAGGGGGATGG + Intronic
1159266656 18:66089198-66089220 CATTCCCAGGGCAAGAGGCAGGG - Intergenic
1160196040 18:76756498-76756520 AGTTCCAAGGGAAGGGGAGATGG + Intergenic
1161139311 19:2638396-2638418 GATGGGAAGGGAAAGGGGGAGGG + Intronic
1161447623 19:4327347-4327369 CATTACAAGGTGAAGCGGGAGGG - Exonic
1161670545 19:5605827-5605849 GATTCCCAGGCAATGGGGGATGG + Intronic
1162382680 19:10340732-10340754 CATTCCAAGGGAAGGCGCCAAGG + Intergenic
1164855841 19:31520048-31520070 CATTGCCATGGAAAGGGGCAGGG + Intergenic
1166674073 19:44728607-44728629 CTTTGCAAGGGCAAGGTGGATGG - Intergenic
1167514335 19:49914337-49914359 CATTTCCAGGGAAAGGAGGAGGG + Intronic
1167717336 19:51152247-51152269 CCTTACAAGTGAAAGGAGGAGGG - Intronic
1168710507 19:58497421-58497443 CATTCCATGGGACAGGGCTAAGG + Intronic
927207210 2:20618207-20618229 CCTTTCCTGGGAAAGGGGGAAGG + Exonic
929426033 2:41845652-41845674 CATTCCAAGGGGAAGAGTGCAGG - Intergenic
929616472 2:43313546-43313568 CTTTCCAAGGGAAAAAGGGCAGG + Intronic
930729945 2:54719355-54719377 CATTCCTAGATAAAGTGGGAAGG - Intergenic
931258722 2:60598263-60598285 CATTGGAAGGGAAAAAGGGATGG + Intergenic
933350676 2:81148479-81148501 CATTGAAAGTGAAAAGGGGAAGG + Intergenic
933495016 2:83039641-83039663 AAGTCCCATGGAAAGGGGGAAGG - Intergenic
934055769 2:88250236-88250258 CATTCCCTGGGACAGAGGGAAGG - Intergenic
935208860 2:100921253-100921275 CATTCCAAGGGGAAGGAGCGAGG - Intronic
936843181 2:116799178-116799200 CATTGCAAGGGAAAAGGAGCAGG - Intergenic
936882024 2:117265175-117265197 CTCTCCTAGGGAAAGGGGGCAGG - Intergenic
937090112 2:119200688-119200710 CTTTCTGAGGGAAATGGGGAAGG - Intergenic
937198451 2:120180781-120180803 CATTCCAAGGTAAAGGGTATCGG - Intergenic
937892876 2:126952853-126952875 TATTGCAAGGGAAGGGGGAAAGG - Intergenic
938660011 2:133476723-133476745 TATTCCACGAGAAAGGGGGAAGG - Intronic
939547617 2:143572414-143572436 CAGGGCAAGGGAAAGGGAGAGGG - Intronic
943829735 2:192445426-192445448 CCTTCCAATGGGAAGAGGGAGGG - Intergenic
944108187 2:196102096-196102118 CATTCACAGGCAAAGGGGAATGG - Intergenic
944150157 2:196548995-196549017 CATTCCAAGGTACAAGGGGTTGG + Intronic
945130819 2:206569996-206570018 CATTCCAGGGGCAGTGGGGAGGG - Intronic
945823919 2:214697660-214697682 CCTGACAAGGGAAAGGGGAAGGG - Intergenic
946060148 2:216934482-216934504 CATGGGGAGGGAAAGGGGGAAGG - Intergenic
946131345 2:217609446-217609468 GAATCCAAGGGGAAGGAGGAAGG + Intronic
946732727 2:222724737-222724759 CAGTCCCAGGGAAAGTAGGATGG + Intergenic
948110877 2:235454839-235454861 TCTTACAGGGGAAAGGGGGAGGG + Intergenic
1169080799 20:2796830-2796852 CATAATAAGGGAAAGTGGGATGG + Intronic
1169787798 20:9378901-9378923 CATTCCAAAGCAAATAGGGAAGG + Intronic
1170819112 20:19740895-19740917 CATTCTAAGGGATTTGGGGAGGG - Intergenic
1170980487 20:21207567-21207589 CCCTCTAAGGGAAAGGGGGGAGG - Intronic
1171151251 20:22828122-22828144 CATTCCAAGGAGATGAGGGAGGG - Intergenic
1171400924 20:24872661-24872683 CATCCCCAGGGGAAGGGGGAGGG + Intergenic
1173550578 20:43930543-43930565 CATTCCCAGGGAGATGGGAAGGG - Intronic
1173551068 20:43933601-43933623 GATTGCAGGAGAAAGGGGGAAGG + Intronic
1173736211 20:45363413-45363435 CATTCCAAGAGTCAGGGGGAAGG - Intronic
1173911355 20:46673402-46673424 CAATGGAAGGGAATGGGGGAAGG - Intronic
1174458205 20:50664533-50664555 GATCCCACGGGAAAGGGGGCTGG + Intronic
1174669058 20:52288906-52288928 CATTCTAAGGGAGATAGGGATGG - Intergenic
1174881588 20:54285108-54285130 CAGTCTCAGGGACAGGGGGAAGG - Intergenic
1175406022 20:58729271-58729293 GTTTCCAAGGGATAGGGGAAGGG + Intergenic
1178086084 21:29113429-29113451 CATGCCAAGAGAAAGAGAGATGG - Intronic
1178501392 21:33128530-33128552 TTTTCCAAGGGAGAGGGGGTGGG - Intergenic
1182351716 22:29703537-29703559 CCTTCCATGGGAAAAGAGGAGGG - Intergenic
1183256215 22:36764109-36764131 CCTTCCAAGGGAAAGGGTATGGG + Intronic
1183293929 22:37019135-37019157 CCTTCCAAGGCAGAGGGGGTGGG + Exonic
1184606676 22:45578445-45578467 GATTCCAAGGGGAAGGCGCATGG + Intronic
1185296996 22:50059206-50059228 CATTCCCCGGGGAAGAGGGAGGG - Intergenic
1185366151 22:50437822-50437844 CACTGCAAGAGCAAGGGGGATGG - Exonic
949344378 3:3063329-3063351 CCATCCAAGGAAAAGTGGGAAGG - Intergenic
950618458 3:14181711-14181733 CATTTCAAGGGAGTGGGGGTAGG - Intronic
950857883 3:16122311-16122333 CAAGCCAAGGGAAAGGCAGAGGG + Intergenic
952659749 3:35831291-35831313 CCTTCCAAGGGCAGGGGGCAAGG + Intergenic
953404897 3:42655169-42655191 ATTTCCAAGGGAAAGAGGGGAGG + Intronic
953566742 3:44038526-44038548 CAGTCCAGGGGAAAGAAGGAAGG - Intergenic
953677527 3:45014876-45014898 CAGTCAAAGGGGATGGGGGATGG + Intronic
954584362 3:51720817-51720839 CAATGCAAGGGACAGGGGAAAGG - Intergenic
954584404 3:51720965-51720987 CCTGACATGGGAAAGGGGGAGGG + Intergenic
955420101 3:58727264-58727286 CCTGCCTGGGGAAAGGGGGAGGG + Intronic
955727529 3:61948996-61949018 CACTCCAAGGAAAAGAGAGAAGG + Intronic
956714367 3:72065230-72065252 CATTCAAAGGAAAAGAGAGAGGG + Intergenic
956953840 3:74313852-74313874 CATAGAAAGGGAAAGGGGCATGG + Intronic
958648670 3:96906834-96906856 CAGACCAAGGGAAGAGGGGAAGG + Intronic
959434803 3:106301414-106301436 CATTTCAAAGGAAAGAAGGATGG - Intergenic
959948775 3:112154676-112154698 CATTCCAAGGGGGAGTGGAAAGG + Intronic
960273345 3:115698697-115698719 AATCCCAAAGGAAAGTGGGAAGG + Intronic
960301517 3:116008719-116008741 CATTTGAAGGGAAAGGAGGTGGG + Intronic
960854787 3:122091933-122091955 CATCCCATGGGGATGGGGGAAGG + Intronic
961103433 3:124221205-124221227 CATGCCAAGGCAGAGAGGGAGGG - Intronic
962007245 3:131361398-131361420 CTATCCTAGGGAAATGGGGATGG - Intergenic
962035623 3:131648429-131648451 CATTCAAAGTGTAATGGGGAAGG - Intronic
962206567 3:133439880-133439902 CATTCCAGTAGAAAGGGAGAGGG + Intronic
965345239 3:167540472-167540494 CATCCCTAGGGGAAGGGGAAGGG + Intronic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966715541 3:183010187-183010209 CATTCCCAGGGGTTGGGGGAGGG + Intergenic
967198070 3:187046601-187046623 CAATGGAAGGCAAAGGGGGATGG + Intronic
967370506 3:188739589-188739611 AATTCCAGGGAAAAGGAGGAGGG + Intronic
967478177 3:189944718-189944740 CATTTTAGGGCAAAGGGGGAGGG - Intergenic
967478390 3:189946732-189946754 CGGTCCCAGGGAAAGTGGGATGG + Intergenic
967595465 3:191322883-191322905 AGTTCCAAGGGAAAGGAGGTTGG - Intronic
969523967 4:7694859-7694881 CTGTCCAAGGGAAAGGGGACTGG - Intronic
969713199 4:8856131-8856153 CAGTCCAATGGAGAGAGGGAGGG + Intronic
970294821 4:14617977-14617999 TATTCTAGGGGATAGGGGGAAGG - Intergenic
970564165 4:17315143-17315165 CAATCAAATGGGAAGGGGGAGGG + Intergenic
970603038 4:17655255-17655277 TATCCCCAGGGAAATGGGGATGG + Intronic
971427416 4:26530201-26530223 CATTCGTAGGGACAGGGGGCAGG + Intergenic
972724218 4:41732113-41732135 CATCCAAAGGCACAGGGGGAGGG + Intergenic
973189958 4:47375644-47375666 CATTACAAGGGAAAAGAGCATGG + Intronic
973340653 4:48999994-49000016 CCTTTTAAGGGAAAGGAGGAGGG - Intronic
975147663 4:70988222-70988244 CATTCCAAGGGAAATATTGATGG + Intronic
975342606 4:73258666-73258688 CATCCCCAGGGAAAGAGGGAGGG + Exonic
975530719 4:75396615-75396637 CCTTCCCAGGGAAACGGGGGTGG - Intergenic
975951114 4:79772269-79772291 CATCCCTAGGGAAAGGGGGAGGG + Intergenic
978328482 4:107586296-107586318 AATTTGAAGGGAGAGGGGGATGG + Intergenic
979293193 4:119000701-119000723 GATTCCAGGAGAAAGGGGAAGGG + Intronic
980290239 4:130840634-130840656 CATTTCAGGGGAGAGGAGGATGG + Intergenic
980790279 4:137611399-137611421 CATTCCAAGGGATAGGCCAATGG + Intergenic
980893390 4:138838097-138838119 CATTCCAGGTGAAAGGGGCAAGG + Intergenic
981139694 4:141254089-141254111 TGTTCCTAGGGGAAGGGGGATGG - Intergenic
989346029 5:40430453-40430475 CTTGCCTAGGGAAAGGGGCAGGG + Intergenic
989652753 5:43711626-43711648 CATTCAAAGGCAAAGTGGGTGGG + Intergenic
991323205 5:65399655-65399677 TATCACAAGGGAAAGGAGGAAGG - Intronic
992306203 5:75441582-75441604 GATTGCCAGGGATAGGGGGAGGG - Intronic
992371332 5:76147047-76147069 CCATCCAAGGGAGAGGGGAATGG + Intronic
994398985 5:99256028-99256050 CATTTCTAGGGGAAGGGGAACGG - Intergenic
994468569 5:100171412-100171434 CCCTCCAAGGGAAAGGGCTAGGG + Intergenic
995337427 5:111016137-111016159 CATTCCAAAGGCAAGGAGGAAGG + Intergenic
995742245 5:115367154-115367176 GATTCCAAGGGGCTGGGGGAAGG - Intergenic
996223840 5:120965387-120965409 AATTAGAAGGGTAAGGGGGAAGG + Intergenic
996502826 5:124235772-124235794 CATTCCAAATCAAAGGGAGAGGG - Intergenic
998429499 5:142058730-142058752 GCTTCCAAGGGAAAGTGGGCAGG + Intergenic
999069404 5:148727944-148727966 TCTTCCAAGGGTAATGGGGATGG - Intergenic
999133260 5:149300388-149300410 CATACACAGGGAAAGAGGGATGG - Intronic
999324152 5:150632732-150632754 GATTCCAAGGGGAAGAGGGCAGG - Intronic
999436983 5:151570793-151570815 ACTTCCAAGGCAAAGGGGGAAGG + Intergenic
999677170 5:154015554-154015576 CATCCTTAGGAAAAGGGGGAAGG + Intronic
999877748 5:155827087-155827109 CAGTCCAAGGCAAACTGGGATGG - Intergenic
999901126 5:156088048-156088070 AGTTCTATGGGAAAGGGGGATGG - Intronic
1000328398 5:160188851-160188873 CACCCCAAGGGGATGGGGGAGGG - Intronic
1001586553 5:172836729-172836751 CATTCCAAGAGAAGGGAGGAGGG + Intronic
1001809071 5:174613340-174613362 CATTCCAAGGTACTGGGGGCTGG - Intergenic
1002706300 5:181162672-181162694 CATTCTGAGGGAAAGAGGGTTGG - Intergenic
1003455480 6:6277930-6277952 CACTTCAAGGGAAAGGAAGATGG - Intronic
1003637062 6:7842099-7842121 CACAACAAGGGAAAGGGGGATGG - Intronic
1003679836 6:8242004-8242026 CCTTCCATGGGACAGAGGGAAGG - Intergenic
1004622692 6:17344824-17344846 GATGGCAAGGGAAAGGGGGTTGG + Intergenic
1007244448 6:40450457-40450479 CATTGCAAGGGAGAGAGGGAGGG + Intronic
1007494404 6:42249684-42249706 CATTCCAAGGGATACAGGGCTGG + Intronic
1009569117 6:65358449-65358471 CATTCCTAGGCAAACTGGGATGG + Intronic
1011191482 6:84734065-84734087 CATTCCAAGGGACATCGCGATGG - Exonic
1012299147 6:97563219-97563241 CATTCCTAGGGGAAAGGGGGTGG - Intergenic
1012958758 6:105599624-105599646 CAGTGAAAGGGAAAGGGGAAAGG + Intergenic
1016164078 6:140917796-140917818 CATTTCAAGGGAAAAGGAGTAGG + Intergenic
1016402778 6:143698880-143698902 CAATCCAAGGGAGAGGAGGAAGG - Intronic
1016425541 6:143932867-143932889 GGCTCCTAGGGAAAGGGGGAGGG - Intronic
1016610970 6:145989108-145989130 CATTACAAGGGAGAGGGAGCGGG + Intergenic
1016793826 6:148096160-148096182 AAATCCAAGGGAAAGCTGGATGG + Intergenic
1017007436 6:150038084-150038106 CATCCCCAGGGCAAGGAGGATGG - Intergenic
1017554034 6:155543849-155543871 AATAAAAAGGGAAAGGGGGAAGG + Intergenic
1018976163 6:168568688-168568710 GTTTCCAAGGGTGAGGGGGAAGG - Intronic
1019772382 7:2891713-2891735 CATACCAGGGGAGGGGGGGAGGG + Intergenic
1019817438 7:3211457-3211479 TATTACAAGGGGGAGGGGGATGG + Intergenic
1021081500 7:16370548-16370570 CATTCCTAGGGAAAGGGAGAGGG + Intronic
1022368449 7:29748021-29748043 TATTCCAGGGGAAAGCAGGAAGG - Intergenic
1023533260 7:41181563-41181585 GATTCCATGGGAAAGCCGGAGGG + Intergenic
1023649942 7:42359165-42359187 CATTCTTAGGCAAAGGGGCATGG - Intergenic
1023988666 7:45114256-45114278 CTGTCCATGGGACAGGGGGAAGG - Intergenic
1024965242 7:55018653-55018675 CAAAAGAAGGGAAAGGGGGAAGG + Intergenic
1025253961 7:57370527-57370549 AATGCCAAGGGGAAGGTGGATGG - Intergenic
1025726343 7:64064912-64064934 CATTTCCAGGGAATGGAGGAGGG + Intronic
1025755163 7:64331418-64331440 CACTCCCAGGGAATGGAGGAGGG + Intronic
1027577680 7:79951085-79951107 TATTTCAAGGGAAGGGGGGAAGG + Intergenic
1028920949 7:96309554-96309576 CATGGCAAAGTAAAGGGGGAAGG - Intronic
1029254836 7:99262672-99262694 CATGGCAAGGGTAAGGAGGAAGG - Intergenic
1031138945 7:117919683-117919705 CATCCCTAGGAAAAGGGGGAGGG + Intergenic
1031550432 7:123105128-123105150 CATGCCGAGTGAAAGGGAGAGGG - Intergenic
1031607866 7:123791555-123791577 TATTCCCAGGAAAAGGGGAAGGG + Intergenic
1032188744 7:129750382-129750404 CCTGGCAAGGGAAAGGGGGAGGG - Intronic
1034411842 7:150946123-150946145 GATGCCAAGGGAAGTGGGGAGGG + Intronic
1035015777 7:155764558-155764580 CACTCCAACAGAAAGGGGGATGG - Intronic
1041240272 8:55843093-55843115 CATTCCAAAGGAATAAGGGAGGG + Intergenic
1042722690 8:71842525-71842547 CAGTTCCAGGGAAAGGGGAAGGG + Exonic
1043450595 8:80362243-80362265 CATTCCAAAAGGAAGGGGAAAGG - Intergenic
1045132972 8:99178298-99178320 CATTTCAAGGGGAGGGGGGAGGG - Intronic
1046033799 8:108816941-108816963 CATCTCTAGGGAAAGGGGGAGGG - Intergenic
1047522989 8:125609790-125609812 CATGCAGAGGGCAAGGGGGAAGG + Intergenic
1047842477 8:128767688-128767710 CATCCCTAGGGGAAGGGGAAGGG + Intergenic
1048374541 8:133811431-133811453 TATTTTAAGGGAATGGGGGAAGG + Intergenic
1048574154 8:135677903-135677925 CACTCCAAGGGGAAGGGCTATGG - Intergenic
1048598716 8:135895549-135895571 CATTCCAAGTAGAAGGAGGAAGG - Intergenic
1048606126 8:135970716-135970738 CCTTGTAAGTGAAAGGGGGAAGG + Intergenic
1048948478 8:139472856-139472878 CATTCCAACAGAAAGGAGAATGG + Intergenic
1049870334 8:144970188-144970210 AATTCCATGGGAAATGAGGACGG - Intergenic
1050790814 9:9466603-9466625 CATTCAAGGAGAAATGGGGAAGG - Intronic
1051019562 9:12525796-12525818 CTTTCTAAGGGAAAGGGGGAAGG + Intergenic
1051064257 9:13083154-13083176 CATCCCAAGGGAGTGGGGGGAGG - Intergenic
1052370869 9:27663179-27663201 AATGGCAAGGGAAAGGAGGATGG - Intergenic
1052630956 9:31038117-31038139 CACACCAAGAGAACGGGGGACGG - Intergenic
1055313975 9:75014525-75014547 TAATGCAAGGGAAAGAGGGAGGG + Intronic
1055676005 9:78661967-78661989 CATTTGAAGGGAAATGGAGAAGG - Intergenic
1055815240 9:80197175-80197197 GATTGCCAGGGAAAGGGGAAGGG - Intergenic
1056249699 9:84734950-84734972 CATTCCAAATGAAAAGGAGAAGG - Intronic
1057531979 9:95857040-95857062 CATTCCTAGGGGGAAGGGGAAGG - Intergenic
1057845601 9:98520230-98520252 CATGCCATGGGATTGGGGGAAGG + Intronic
1058249196 9:102669734-102669756 CACTGCACGGGAATGGGGGAGGG + Intergenic
1059028402 9:110662388-110662410 GATTACAAGGGACTGGGGGAGGG - Intergenic
1059398885 9:114056368-114056390 CATTCCCAGGGAGAAGAGGAAGG + Exonic
1061259030 9:129469530-129469552 AATTGCATGGGGAAGGGGGAGGG - Intergenic
1061836165 9:133331626-133331648 CAGACCCAGGGAAAGGGTGAGGG - Exonic
1061887454 9:133599020-133599042 CACTCACAGGGAAGGGGGGAGGG - Intergenic
1062095453 9:134700896-134700918 GAGCCCAAGTGAAAGGGGGAAGG - Intronic
1062389406 9:136327960-136327982 CAAGCCAAGGGGAAGGGGGTGGG + Intronic
1186140463 X:6566810-6566832 CAAACCAAGGGAGAGTGGGAGGG + Intergenic
1186877518 X:13830928-13830950 CACTGCAAGGGAAAGGGGGCAGG + Intronic
1187039583 X:15579552-15579574 CATTGCAAGAGAAAGGGGGAAGG + Intronic
1187579437 X:20592567-20592589 CACTGCCAGGGAATGGGGGAGGG + Intergenic
1187794944 X:22993617-22993639 CATTCGACAGGAAAGGCGGAGGG - Intergenic
1189250576 X:39598227-39598249 CACTCCTAGGGACAAGGGGAAGG + Intergenic
1189567291 X:42255581-42255603 CATTCCTAGGGGAAGGGGAAGGG + Intergenic
1189603261 X:42649264-42649286 CATCCATAGGAAAAGGGGGAGGG + Intergenic
1190033408 X:46996702-46996724 CCTTACAAGAGAAAGGTGGAGGG - Intronic
1191174762 X:57486793-57486815 CATTCAAAGGGTAAGAGGAATGG - Intronic
1191671767 X:63754895-63754917 CTTTCAAAGGGAAAGGCGGGGGG + Exonic
1194101081 X:89704847-89704869 CTTTCCATTGGAAAGTGGGAAGG - Intergenic
1195710635 X:107770972-107770994 CAGTCCTAGGGAAACTGGGATGG - Intronic
1198276779 X:135102056-135102078 CCTTACAAGGGGATGGGGGAGGG - Intergenic
1198663291 X:138995108-138995130 CATTGCTAGGGGATGGGGGAGGG - Intronic
1199412956 X:147546368-147546390 CATTACAAGTGAATGGGGAAAGG + Intergenic
1199493475 X:148426930-148426952 AATTTCTAGTGAAAGGGGGAAGG + Intergenic
1199688017 X:150281523-150281545 CATACCAAGGGAAAGGGAGAAGG - Intergenic
1200279587 X:154765222-154765244 CATTTAAAGAGAAAGGGGGATGG - Intronic
1200454034 Y:3365931-3365953 CTTTCCATTGGAAAGTGGGAAGG - Intergenic
1201265876 Y:12206042-12206064 CATTTTAACAGAAAGGGGGAGGG + Intergenic
1201758134 Y:17512140-17512162 GTTTCCAGGGGATAGGGGGAAGG + Intergenic
1201843421 Y:18393850-18393872 GTTTCCAGGGGATAGGGGGAAGG - Intergenic