ID: 1103318273

View in Genome Browser
Species Human (GRCh38)
Location 12:120074468-120074490
Sequence CTGCCTTATCTGTTCTTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 226}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103318273_1103318279 17 Left 1103318273 12:120074468-120074490 CCTTAGAAGAACAGATAAGGCAG 0: 1
1: 0
2: 2
3: 22
4: 226
Right 1103318279 12:120074508-120074530 AGCCCTAAGGGAGCTCATGGAGG 0: 1
1: 0
2: 2
3: 28
4: 393
1103318273_1103318280 18 Left 1103318273 12:120074468-120074490 CCTTAGAAGAACAGATAAGGCAG 0: 1
1: 0
2: 2
3: 22
4: 226
Right 1103318280 12:120074509-120074531 GCCCTAAGGGAGCTCATGGAGGG 0: 1
1: 0
2: 1
3: 14
4: 179
1103318273_1103318285 27 Left 1103318273 12:120074468-120074490 CCTTAGAAGAACAGATAAGGCAG 0: 1
1: 0
2: 2
3: 22
4: 226
Right 1103318285 12:120074518-120074540 GAGCTCATGGAGGGAGAGAGGGG 0: 1
1: 1
2: 15
3: 166
4: 959
1103318273_1103318283 25 Left 1103318273 12:120074468-120074490 CCTTAGAAGAACAGATAAGGCAG 0: 1
1: 0
2: 2
3: 22
4: 226
Right 1103318283 12:120074516-120074538 GGGAGCTCATGGAGGGAGAGAGG 0: 1
1: 0
2: 4
3: 78
4: 696
1103318273_1103318276 4 Left 1103318273 12:120074468-120074490 CCTTAGAAGAACAGATAAGGCAG 0: 1
1: 0
2: 2
3: 22
4: 226
Right 1103318276 12:120074495-120074517 GTGAGGACTCGAGAGCCCTAAGG 0: 1
1: 0
2: 0
3: 7
4: 115
1103318273_1103318277 5 Left 1103318273 12:120074468-120074490 CCTTAGAAGAACAGATAAGGCAG 0: 1
1: 0
2: 2
3: 22
4: 226
Right 1103318277 12:120074496-120074518 TGAGGACTCGAGAGCCCTAAGGG 0: 1
1: 0
2: 0
3: 5
4: 64
1103318273_1103318278 14 Left 1103318273 12:120074468-120074490 CCTTAGAAGAACAGATAAGGCAG 0: 1
1: 0
2: 2
3: 22
4: 226
Right 1103318278 12:120074505-120074527 GAGAGCCCTAAGGGAGCTCATGG 0: 1
1: 0
2: 2
3: 14
4: 196
1103318273_1103318284 26 Left 1103318273 12:120074468-120074490 CCTTAGAAGAACAGATAAGGCAG 0: 1
1: 0
2: 2
3: 22
4: 226
Right 1103318284 12:120074517-120074539 GGAGCTCATGGAGGGAGAGAGGG 0: 1
1: 1
2: 3
3: 79
4: 710

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103318273 Original CRISPR CTGCCTTATCTGTTCTTCTA AGG (reversed) Intronic