ID: 1103318275

View in Genome Browser
Species Human (GRCh38)
Location 12:120074492-120074514
Sequence TAGGGCTCTCGAGTCCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 64}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103318275_1103318278 -10 Left 1103318275 12:120074492-120074514 CCAGTGAGGACTCGAGAGCCCTA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1103318278 12:120074505-120074527 GAGAGCCCTAAGGGAGCTCATGG 0: 1
1: 0
2: 2
3: 14
4: 196
1103318275_1103318279 -7 Left 1103318275 12:120074492-120074514 CCAGTGAGGACTCGAGAGCCCTA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1103318279 12:120074508-120074530 AGCCCTAAGGGAGCTCATGGAGG 0: 1
1: 0
2: 2
3: 28
4: 393
1103318275_1103318283 1 Left 1103318275 12:120074492-120074514 CCAGTGAGGACTCGAGAGCCCTA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1103318283 12:120074516-120074538 GGGAGCTCATGGAGGGAGAGAGG 0: 1
1: 0
2: 4
3: 78
4: 696
1103318275_1103318284 2 Left 1103318275 12:120074492-120074514 CCAGTGAGGACTCGAGAGCCCTA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1103318284 12:120074517-120074539 GGAGCTCATGGAGGGAGAGAGGG 0: 1
1: 1
2: 3
3: 79
4: 710
1103318275_1103318285 3 Left 1103318275 12:120074492-120074514 CCAGTGAGGACTCGAGAGCCCTA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1103318285 12:120074518-120074540 GAGCTCATGGAGGGAGAGAGGGG 0: 1
1: 1
2: 15
3: 166
4: 959
1103318275_1103318280 -6 Left 1103318275 12:120074492-120074514 CCAGTGAGGACTCGAGAGCCCTA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1103318280 12:120074509-120074531 GCCCTAAGGGAGCTCATGGAGGG 0: 1
1: 0
2: 1
3: 14
4: 179
1103318275_1103318286 13 Left 1103318275 12:120074492-120074514 CCAGTGAGGACTCGAGAGCCCTA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1103318286 12:120074528-120074550 AGGGAGAGAGGGGTAAACTGAGG 0: 1
1: 0
2: 6
3: 83
4: 674

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103318275 Original CRISPR TAGGGCTCTCGAGTCCTCAC TGG (reversed) Intronic