ID: 1103318280

View in Genome Browser
Species Human (GRCh38)
Location 12:120074509-120074531
Sequence GCCCTAAGGGAGCTCATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103318275_1103318280 -6 Left 1103318275 12:120074492-120074514 CCAGTGAGGACTCGAGAGCCCTA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1103318280 12:120074509-120074531 GCCCTAAGGGAGCTCATGGAGGG 0: 1
1: 0
2: 1
3: 14
4: 179
1103318273_1103318280 18 Left 1103318273 12:120074468-120074490 CCTTAGAAGAACAGATAAGGCAG 0: 1
1: 0
2: 2
3: 22
4: 226
Right 1103318280 12:120074509-120074531 GCCCTAAGGGAGCTCATGGAGGG 0: 1
1: 0
2: 1
3: 14
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103318280 Original CRISPR GCCCTAAGGGAGCTCATGGA GGG Intronic
900169366 1:1258821-1258843 GCCATGAGGCAGCTCATAGAGGG - Intronic
902668339 1:17954656-17954678 GCCCTAAGCCAGCTCCTGGCTGG + Intergenic
903779208 1:25810781-25810803 GCCCTAGGTGAGCAGATGGAGGG - Intronic
904575269 1:31501418-31501440 GCCTGAAGGAAGCCCATGGAAGG + Intergenic
905369802 1:37476903-37476925 GCCCTGAGGGAGCTCCTAGGTGG + Intronic
905824018 1:41015837-41015859 GCCCTAGGGGAGCTCTGGGCAGG + Exonic
906791169 1:48659789-48659811 GCACTAATGGAGCACATGGCCGG - Intronic
907898078 1:58711490-58711512 GCCCTTAAGAAGCTCATGGCTGG - Intergenic
907921303 1:58915252-58915274 GTACTTTGGGAGCTCATGGAGGG + Intergenic
910655804 1:89616696-89616718 GCCATAAGGAGGCTCATAGATGG + Intergenic
912451627 1:109770843-109770865 GCCCTAGGGGATCTCAGGGGAGG + Intronic
912702900 1:111891514-111891536 GCCCTTCGGGAGCTGAGGGAGGG - Intronic
913225775 1:116696842-116696864 GCCCCAAGTGTGCTCATGCAGGG - Intronic
914756104 1:150562358-150562380 GCCGAGAGGGAGCTCATGGGCGG - Intergenic
916309264 1:163376349-163376371 GCACTTTGGGAGCTCAAGGAAGG - Intergenic
917718446 1:177761355-177761377 GCCCTAAAAGAGCTCCTGAAGGG + Intergenic
921133070 1:212236343-212236365 AACCTAAAGGAGCTCTTGGAAGG - Intergenic
922353959 1:224758873-224758895 GCCCTAGGGGAGCAGATGGGAGG + Intergenic
922783458 1:228271665-228271687 GCCCTGGAGGAGCTCATGCATGG + Intronic
1064265789 10:13824229-13824251 GCACTAAGGGAGACCAAGGAGGG + Intronic
1070028760 10:72656808-72656830 GCACTTTGGGAGGTCATGGAGGG + Intergenic
1074550113 10:114434886-114434908 GCGCTGATGTAGCTCATGGAAGG - Intronic
1076047411 10:127305585-127305607 GCCCTCAGGGAGCTCAGACAAGG + Intronic
1079312474 11:19378840-19378862 GCCCTCAGGGAGCTCAGAGCGGG - Intronic
1079381995 11:19946340-19946362 GCCCTTATGAAGCTCATGGTTGG + Intronic
1080199567 11:29652837-29652859 CTCCTAAGGGAGCTTGTGGAGGG - Intergenic
1081890324 11:46536268-46536290 GCCTTCAGGGAGCTCACTGACGG + Intronic
1081904832 11:46661579-46661601 GCCCTTAGGGAGGCCAAGGAAGG + Intronic
1086050800 11:82588230-82588252 GCCCTAAGGGAGCTTAAAAAGGG + Intergenic
1089734410 11:120539793-120539815 GGCTTAATGGAGCTCCTGGAGGG + Intronic
1089964782 11:122647025-122647047 GCCCTAAGGAAGCTCCTAGGAGG + Intergenic
1093245832 12:16735394-16735416 GGCCTAAGGGAATTCATGGTAGG + Intergenic
1094042709 12:26134372-26134394 GCACAAAGGGAGCTGATAGAAGG - Intronic
1094083338 12:26561801-26561823 GCTTTAAGGAAGCTCTTGGAGGG - Exonic
1094137945 12:27149361-27149383 GCACTTTGGGAGGTCATGGAGGG + Intergenic
1095385113 12:41641584-41641606 GCCCTAAAAGAGCTCCTGAAGGG - Intergenic
1096180404 12:49547592-49547614 GCCCTCAGGGAGCTCCTGTGGGG + Intronic
1100136821 12:91563148-91563170 GCCCAAACTGAGCTCATGAAAGG - Intergenic
1103318280 12:120074509-120074531 GCCCTAAGGGAGCTCATGGAGGG + Intronic
1104221335 12:126787493-126787515 GCCCTGGGGGAGCTCCTGGCTGG + Intergenic
1105011656 12:132760906-132760928 GCCCCTAGGGAGCTTCTGGATGG - Intronic
1105488170 13:20858623-20858645 GCACTTAGGGAGGTCAAGGAGGG + Intronic
1115147064 14:30238273-30238295 ACCCCAAGGGAGCTGATGAAGGG + Intergenic
1119155033 14:72402186-72402208 GCCCTGAGAGAGATCTTGGACGG - Intronic
1121583878 14:95049710-95049732 ACCCCAAGGGAGCTCCTGTATGG - Intergenic
1121683113 14:95810787-95810809 GGTCTAAGCGAGCTAATGGAAGG + Intergenic
1126921156 15:53526348-53526370 ACCCAAAGGGAGCTCATTCAAGG + Intronic
1127031957 15:54873660-54873682 GCCCTAAAAGAGCTCCTGAAGGG + Intergenic
1127818337 15:62632485-62632507 GCCCTGTGGAAGCTCTTGGAGGG + Intronic
1128247717 15:66144309-66144331 GCTCTCAGGGAGCTCCTGGTGGG - Intronic
1130067450 15:80616431-80616453 GCCTTTAGGGAGATAATGGAGGG - Intergenic
1132678022 16:1128726-1128748 GCCCTATGGGAGACCAGGGAGGG - Intergenic
1133981485 16:10636040-10636062 GCCCTAAAGGTGCTCAAGGCCGG - Intronic
1134913484 16:18050141-18050163 GCCCTTAGGGAGCTGAATGATGG + Intergenic
1135480235 16:22815389-22815411 GCCCTTAGGGTGCCCAAGGAAGG + Intronic
1145690863 17:26737666-26737688 GCCCTAAAAGAGCTCCTGAAGGG + Intergenic
1147260946 17:39209669-39209691 GCCCAAAGAAAGCTCAAGGAGGG + Intergenic
1147605340 17:41770981-41771003 GCTCTCAGGGAGCCCATGGATGG - Intronic
1149480342 17:56998426-56998448 GCCTTAAGCCAGCTCATGAATGG + Exonic
1149701675 17:58660487-58660509 GCTGTAGGGGAGCTCAGGGAGGG + Intronic
1149742261 17:59057768-59057790 GCCCTTTGGGAGGTCAAGGAGGG - Intronic
1152728699 17:81959829-81959851 GCCCACGGGGAGCTCAGGGACGG + Intronic
1155416128 18:25601632-25601654 GACATAGGGGAGATCATGGAGGG - Intergenic
1156527196 18:37778278-37778300 GCCCTGAGGGAGCTCACTGCAGG - Intergenic
1156886752 18:42143519-42143541 TCCCTAAAGGATCTCATGTAAGG - Intergenic
1158351960 18:56572575-56572597 GCCGCACAGGAGCTCATGGAGGG - Intergenic
1159472905 18:68880071-68880093 GCCCCACGGGAGCCCATGGAGGG + Intronic
1160903573 19:1441221-1441243 GCCATCAGAGAGCCCATGGAGGG - Intergenic
1161979124 19:7621386-7621408 GCCCCAAGGGAGTTCCTGGCAGG - Intronic
1162457617 19:10795538-10795560 GCCTTAAGAGGGCTCTTGGATGG + Intronic
1163731427 19:18951741-18951763 GCCCTCAGGGACCTCATGTCTGG + Intergenic
1165106031 19:33470144-33470166 GGCCTGAGGGAGGTCGTGGAGGG - Intronic
1165755990 19:38293275-38293297 GCCCTAAGGGATTTCTAGGAAGG - Intronic
925868597 2:8250238-8250260 TATCTAAGGGAGCTCAGGGATGG - Intergenic
926145097 2:10392285-10392307 GCCCTAAGGGAGGCCAAGGTGGG - Intronic
927497982 2:23563431-23563453 GCCCCAAGGGGGCTCCTGGGAGG - Intronic
927605447 2:24482658-24482680 GCCCTTAGACAACTCATGGAGGG - Intergenic
928398871 2:30963969-30963991 GCCCTAAAGGAGCTCACTGAAGG + Intronic
929965280 2:46529948-46529970 GCACTCAGGGAGCTCAGGGTAGG + Intronic
930840005 2:55835687-55835709 GCCCTAAAAGAGCTCCTGAAGGG - Intergenic
930848415 2:55931433-55931455 GCCCTTAGGGAGCTGTTGGGTGG + Intergenic
932777904 2:74539474-74539496 GAACTAAGGGAGGTGATGGAGGG + Intronic
935338813 2:102041696-102041718 GCCTTCAGGGAGCCCAGGGAAGG - Intergenic
936612677 2:114017139-114017161 GCCCTAAAAGAGCTCCTGAAGGG - Intergenic
937262551 2:120595767-120595789 GCCTGTAGGGAGCTCATGGCTGG + Intergenic
937450508 2:121998642-121998664 GCCCTGAGGAAGCACATGGCTGG + Intergenic
937576493 2:123428849-123428871 GCCCTAAAGGAGCTGATAGCAGG - Intergenic
939738737 2:145880975-145880997 ACCCCACGGGAGCCCATGGAGGG + Intergenic
940011088 2:149056312-149056334 GTCCCCAGGGTGCTCATGGAGGG + Intronic
941934023 2:170969399-170969421 GCCCTAAGGGAGCTCACAGTAGG + Intergenic
942625983 2:177901254-177901276 GCCCTGAGTTAGCTCATGGATGG - Intronic
943627022 2:190213017-190213039 ACACTAAGGCAACTCATGGAGGG - Exonic
945791451 2:214310579-214310601 GCCCTAATGAAGCTCATGGAGGG + Intronic
946294241 2:218771131-218771153 GCCCTTAGGGAGCTCTTATAAGG + Intergenic
946362850 2:219229444-219229466 GCCCTAAGTGAGCTCGCGGCGGG - Intronic
948435021 2:237947238-237947260 GCCCTTTGGGAGCCCATGGTGGG - Intergenic
1171200358 20:23235702-23235724 GCCCTATGGTGGCTCAAGGAAGG + Intergenic
1171344624 20:24456697-24456719 GCGCCAAGGGAGGTCAGGGAGGG + Intergenic
1172124493 20:32617254-32617276 GCCCTCAGGGAGCTCATTCTAGG - Intergenic
1172835041 20:37868018-37868040 GCCCTGAGGGGGCACGTGGATGG - Intronic
1174108053 20:48177008-48177030 GGCCAAAGGGAGCTCTTGCATGG + Intergenic
1176241089 20:64076323-64076345 GGCCCCAGGGAGCTCATGTATGG - Intronic
1176252902 20:64134058-64134080 CCCCCAAGGCAGCTCAGGGAGGG + Intergenic
1176674650 21:9767335-9767357 GCCCTGCGGAAGCTCAGGGAGGG - Intergenic
1176674770 21:9767971-9767993 GCCCTGCGGAAGCTCACGGAGGG - Intergenic
1176674822 21:9768213-9768235 GCCCTGCGGAAGCTCAGGGAGGG - Intergenic
1176674910 21:9768593-9768615 GCCCTGCGGAAGCTCAGGGAGGG - Intergenic
1178165222 21:29966793-29966815 GCACAAAGGGAGAACATGGAGGG - Intergenic
1178169269 21:30020517-30020539 GCAGAAAGGGAGCTCATGGATGG + Intergenic
1179361801 21:40716499-40716521 ACACTAAGGGAGCTAATGGGAGG + Intronic
1181050656 22:20236849-20236871 GCCCTGGAGGAGCTCATAGAGGG - Intergenic
1182353663 22:29712561-29712583 GCCCAAAGGGAGATGTTGGAGGG + Intergenic
1182947256 22:34334825-34334847 GTCCAAAGGGAGCTGGTGGATGG + Intergenic
1183434129 22:37783484-37783506 GCCACAAGGGAGCTCATGGCGGG - Intergenic
1183620541 22:38969557-38969579 GCACTATGGGAGGTCAAGGATGG - Intronic
1184406849 22:44305306-44305328 GCCCTCAGGGAGCACAGGCAAGG + Intronic
1184584295 22:45437013-45437035 GCCGCACAGGAGCTCATGGAGGG - Intergenic
953877430 3:46674248-46674270 GCTCTGAGGGAGCTGTTGGAAGG + Intronic
954334700 3:49909510-49909532 GTCCTAAGGGAGCACCTGGAGGG - Intronic
954381484 3:50221327-50221349 GCCCTGAGGGAGCCCCAGGAAGG + Intergenic
954475686 3:50743168-50743190 GCCCTAAAAGAGCTCCTTGAAGG + Intronic
956940967 3:74161129-74161151 GCCCTAAAAGAGCTCCTGAAGGG - Intergenic
959607678 3:108259518-108259540 GCCCTAAAAGAGCTCCTTGAAGG + Intergenic
960445516 3:117744443-117744465 GCTCTAATGGAGCTCATGATCGG + Intergenic
961332963 3:126153776-126153798 GGCCTCAGGGAGCTGATGGCAGG + Intronic
961590093 3:127972532-127972554 GCCCTAACAGAGCTCATTGAGGG + Intronic
961715261 3:128853427-128853449 GCCCTTGGGGAGCTCAAGCAAGG + Intergenic
961901977 3:130221820-130221842 GCCCTAAGGGAGAAAAAGGAAGG + Intergenic
963026377 3:140923281-140923303 GCACTAAGGGATGTCAGGGAGGG + Intergenic
970474244 4:16406557-16406579 GCCCTAAAAGAGCTCCTGAAGGG - Intergenic
971555597 4:28010872-28010894 GTCCAAAGGGAGCTGGTGGACGG + Intergenic
972465621 4:39353734-39353756 GTTCTAAGTGAGCTCATAGATGG + Intronic
976649876 4:87422891-87422913 GCCCTCGGGGCGCTCATGGCGGG + Exonic
981011852 4:139933304-139933326 GCTCTAAGGATGCTCATGGGCGG - Intronic
982345455 4:154352841-154352863 GACCTTGTGGAGCTCATGGAGGG + Intronic
985400644 4:189590102-189590124 GCCCTGCGGAAGCTCAGGGAGGG + Intergenic
986038388 5:3962602-3962624 GCAGTAAAGGAGCTCAGGGAAGG - Intergenic
988143033 5:27267327-27267349 GCCGTAAGGGAGCCCATGGTGGG + Intergenic
990457757 5:56004629-56004651 TCACTAAGGGAGATAATGGAGGG + Intergenic
992594435 5:78331452-78331474 GCCCTTTGGGAGCTCAAGGCAGG - Intergenic
1002019637 5:176354781-176354803 GTCCTCAGGAAGCTAATGGAGGG + Intronic
1002447374 5:179297752-179297774 GCCCTGAGGGAGCTGGTGGTGGG - Intronic
1003040732 6:2685255-2685277 GCCCTTGGGGAGGTCAGGGAGGG + Intronic
1003116686 6:3288144-3288166 GCCCTGAGGCACCCCATGGATGG - Intronic
1003581479 6:7344502-7344524 GCCGCACAGGAGCTCATGGAGGG - Intronic
1006635946 6:35461268-35461290 GCCCTTTGGGAGGTCAAGGAGGG - Intronic
1007095149 6:39208359-39208381 GCCCCCAGGGAGCTCATTCAAGG + Intronic
1007432023 6:41782013-41782035 GCCCTCAAGGAGCTCATAGTGGG - Intronic
1007775282 6:44221587-44221609 GACCTGAGGGAGCTCAGGGAGGG + Intronic
1007957254 6:45929282-45929304 TCCCTCAGGCAGCTCATGGGAGG + Intronic
1008261283 6:49368924-49368946 CACCTTAGGGAGCTCATGGGAGG - Intergenic
1008873172 6:56296968-56296990 GCCTTCAGACAGCTCATGGATGG - Intronic
1009249574 6:61281352-61281374 GACATATGGGAGCTCATTGAAGG - Intergenic
1010235606 6:73572610-73572632 GCCGTACAGGAGCCCATGGAGGG + Intergenic
1010435858 6:75830103-75830125 TCCCTGAGGAAGCACATGGAAGG + Intronic
1011116705 6:83901129-83901151 GCCCTAAAAGAGCTCCTGAAGGG - Intronic
1013533782 6:111044522-111044544 GAACTGAGGGAGATCATGGAAGG - Intergenic
1013968475 6:115985281-115985303 ACCCAAAGAGAGCTCATGAAAGG - Intronic
1017325128 6:153133908-153133930 GCCGCAGGGGAGCCCATGGAGGG - Intergenic
1017441509 6:154468324-154468346 GCCCTGTGGGAGATCAAGGAGGG - Intronic
1022791752 7:33696099-33696121 ACCCTAAGGGTCCTCAGGGAAGG - Intergenic
1023207430 7:37766045-37766067 ACTCTAAAGGAGCTCATGTAAGG - Intronic
1025267048 7:57471168-57471190 GCACTTTGGGAGCTCATGGCAGG + Exonic
1027822449 7:83064204-83064226 ACCATAAGAGAGCTCATGAAAGG + Intronic
1033992194 7:147302271-147302293 GCATTCAGGGAGCTCATGTATGG - Intronic
1034101282 7:148452581-148452603 GTCCTACAGGATCTCATGGAAGG - Intergenic
1034632105 7:152538962-152538984 GCCGCACGGGAGCCCATGGAGGG + Intergenic
1035120865 7:156565481-156565503 GCACTAATGGTGCTCATGGAGGG + Intergenic
1035229135 7:157452579-157452601 GCCCTAAAAGAGCTCCTGAAGGG - Intergenic
1037595491 8:20350883-20350905 GGCCTGGGGGAGCTCATAGAAGG - Intergenic
1039165018 8:34669119-34669141 GCCCTTTGGGAGCCCAAGGAGGG + Intergenic
1042684065 8:71418002-71418024 GCCCTAAGGCAGCTCAGAGAAGG - Intronic
1044826569 8:96204060-96204082 ACCCTAAGGCAGCTGATGGTGGG - Intergenic
1048463909 8:134646524-134646546 GCCCAAAGTGAGCAGATGGAAGG + Intronic
1049108304 8:140627128-140627150 GCTCTAAGTGAGCTTATGCAGGG - Intronic
1049539517 8:143201594-143201616 GCCTAAAGAGTGCTCATGGAAGG + Intergenic
1051749266 9:20324553-20324575 GCCCTGAAGGACCTCATGGGAGG - Intergenic
1056703859 9:88934843-88934865 GTCCTGAGGGAGGTGATGGAAGG - Intergenic
1056743789 9:89282710-89282732 GCCCCACAGGAGCCCATGGAGGG - Intergenic
1056974654 9:91240778-91240800 ACCAAAAGGGAGCTCATGGGAGG - Intronic
1058496618 9:105565124-105565146 GCCCTAAAAGAGCTCCTGAAGGG + Intronic
1058883712 9:109306923-109306945 GCTCTAAAGGAGCTCATTTAGGG - Intronic
1059140013 9:111844268-111844290 GCTCTCAGAGAGCACATGGAAGG - Intergenic
1059655830 9:116356472-116356494 GCTCTATGTGAGCTCCTGGAGGG + Intronic
1060794972 9:126507263-126507285 GCCCTCGGGGTGCTCCTGGAAGG + Intergenic
1061322804 9:129841899-129841921 GCCCTGAGTGGTCTCATGGAGGG + Intronic
1061723304 9:132567062-132567084 CCCAGAAGGGAGCTCAAGGAAGG - Intronic
1062474514 9:136720501-136720523 GCCCCACGGGAGGTGATGGAGGG - Intronic
1062693212 9:137856443-137856465 GCCCTAGAGGAGCACATGCAGGG + Intronic
1186614933 X:11176359-11176381 GCACAAAGCCAGCTCATGGAAGG + Intronic
1190189217 X:48262531-48262553 GCCCTCAAGGAGCTCAAGGAGGG - Intronic
1190657977 X:52629013-52629035 ACCCTTAAGGAGCTCAAGGAGGG - Intergenic
1192243940 X:69357996-69358018 GCACTAAGGGAACTTATTGAGGG + Intergenic
1194978858 X:100419926-100419948 GCCCTCAAGGATCTCGTGGAAGG + Intergenic
1199889049 X:152056821-152056843 GCACTAAGGGAGGTCAAGGTGGG - Intergenic