ID: 1103318765

View in Genome Browser
Species Human (GRCh38)
Location 12:120077951-120077973
Sequence GAGGGAAACCAGAGGGACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 272}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103318765_1103318776 21 Left 1103318765 12:120077951-120077973 CCTGCGTCCCTCTGGTTTCCCTC 0: 1
1: 0
2: 0
3: 18
4: 272
Right 1103318776 12:120077995-120078017 AACTGAACATAGGATACAAAGGG 0: 1
1: 0
2: 2
3: 36
4: 411
1103318765_1103318774 11 Left 1103318765 12:120077951-120077973 CCTGCGTCCCTCTGGTTTCCCTC 0: 1
1: 0
2: 0
3: 18
4: 272
Right 1103318774 12:120077985-120078007 GCTTTAGCAGAACTGAACATAGG 0: 1
1: 0
2: 1
3: 8
4: 103
1103318765_1103318777 27 Left 1103318765 12:120077951-120077973 CCTGCGTCCCTCTGGTTTCCCTC 0: 1
1: 0
2: 0
3: 18
4: 272
Right 1103318777 12:120078001-120078023 ACATAGGATACAAAGGGCAGTGG 0: 1
1: 0
2: 0
3: 17
4: 225
1103318765_1103318775 20 Left 1103318765 12:120077951-120077973 CCTGCGTCCCTCTGGTTTCCCTC 0: 1
1: 0
2: 0
3: 18
4: 272
Right 1103318775 12:120077994-120078016 GAACTGAACATAGGATACAAAGG 0: 1
1: 0
2: 0
3: 17
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103318765 Original CRISPR GAGGGAAACCAGAGGGACGC AGG (reversed) Intronic
900279857 1:1859706-1859728 GTGGGAAAGAAGAGGGAGGCAGG + Intronic
901964979 1:12859194-12859216 CAGCGATACCAGAGGGAGGCAGG - Exonic
902005125 1:13225900-13225922 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902024350 1:13371694-13371716 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902194651 1:14789390-14789412 GTGGGGAAGCAGAGGGAAGCAGG - Intronic
904330545 1:29755517-29755539 GAGGGAGACCCCAGGGAGGCAGG + Intergenic
905101830 1:35531007-35531029 GTGGGAGACAAGAGGGAGGCAGG + Intronic
906209107 1:44002480-44002502 GAGGGAAACCGGAAGGGGGCTGG - Intronic
907265959 1:53261434-53261456 GAGGGAAAGCAAAGGGATGATGG - Intronic
907669630 1:56463283-56463305 GAGGGAACCCTGAGGAACACTGG + Intergenic
908167606 1:61473888-61473910 GAGGGGAACCAGAGGGAGCCAGG - Intergenic
911094656 1:94045585-94045607 GAGAGAAAGCAGATGGATGCAGG + Intronic
912872855 1:113326132-113326154 GAGGGAAACCAGAATGAAGCTGG - Intergenic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
915105577 1:153533393-153533415 GCGGGAACCTAGAGGGGCGCGGG + Intergenic
915346977 1:155202542-155202564 GAGGGAACCCCGAGGGAAGTGGG - Intronic
915393393 1:155563365-155563387 GAGGGAAAGGAGCGGGACTCCGG + Intergenic
915409516 1:155689210-155689232 GAGGGAAAGGAGCGGGACTCCGG + Intronic
915483061 1:156200302-156200324 GGGGGAACCCAGAGGGACAAGGG + Exonic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
916052873 1:161048463-161048485 GAGGGAGACCAGAGGGCTGGAGG - Exonic
919298773 1:195734825-195734847 GAGGGCAACCAGGAGGGCGCTGG - Intergenic
920667602 1:207975340-207975362 GAAAGAAACTAGAGGGAGGCTGG + Intergenic
920680764 1:208070879-208070901 GAAGAAATCCAGAGGGAAGCTGG + Intronic
922937625 1:229433938-229433960 GAGGGGAACCTGAAGGACTCCGG - Intronic
924926357 1:248686996-248687018 GAAGGAAGCCTGGGGGACGCTGG + Intergenic
1063001924 10:1932659-1932681 TAGGGGAACCAGAGGCCCGCCGG + Intergenic
1070712454 10:78692612-78692634 GAGGGAAACCAGAGAGAAAGAGG + Intergenic
1071450731 10:85789885-85789907 GGGGGAAGCCAGAGGGTCCCAGG - Intronic
1072413992 10:95231657-95231679 AAGGAAAGCCAGAGGCACGCAGG + Intergenic
1074753317 10:116607445-116607467 GGAGGAAAGCAGAGGGCCGCGGG + Intronic
1076288193 10:129321990-129322012 GAGGGAGACAAGAAGGAGGCCGG - Intergenic
1076892025 10:133289597-133289619 GATGGAAACCTGAGGGAACCTGG + Intronic
1076930407 10:133528362-133528384 TAGAGAACCCAGAGGGACGTGGG - Intronic
1077682911 11:4262580-4262602 GAGGGAGACCAGAGGAACAATGG + Intergenic
1077687128 11:4304178-4304200 GAGGGAGACCAGAGGAACAATGG - Intergenic
1077692292 11:4355367-4355389 GAGGGAGACCAGAGGAACAATGG - Intergenic
1077953811 11:6991356-6991378 TAGGGAAACCAGAGGCAGGGAGG - Intergenic
1078098326 11:8313742-8313764 GAGGGCACCCAGAGGGAAGGTGG + Intergenic
1078329018 11:10403388-10403410 GATGGACATCAGAGGGACACAGG - Intronic
1078916515 11:15783694-15783716 GAGGGAAAGGAGAGGCCCGCTGG + Intergenic
1081630843 11:44688558-44688580 GCGGGAAACCAGAGGGAAGAAGG + Intergenic
1082000127 11:47389653-47389675 GGGGGAAACTAGAGGGAAGGCGG - Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083631768 11:64099115-64099137 GTGGCAATCCAGAGGGAGGCAGG - Intronic
1083742508 11:64718334-64718356 GAGGAGAGCCAGAGGGAGGCCGG - Intronic
1083807041 11:65080638-65080660 GAGAGAAATCAGAAGGTCGCTGG - Intronic
1086380158 11:86244555-86244577 GGGGGAAGCCAGGGGGAAGCAGG + Exonic
1089356618 11:117858133-117858155 GATGGGAAGCAGGGGGACGCTGG - Intronic
1089369375 11:117944146-117944168 GAGGTAAACCAGAGAAAGGCAGG + Intergenic
1090011274 11:123047918-123047940 TTGGGAATCCGGAGGGACGCTGG + Intergenic
1091534362 12:1391591-1391613 CAGGGAAAGCCGAGGGAGGCAGG - Intronic
1092286111 12:7130138-7130160 GTGGGAAAGAAGAGGGACGTGGG - Intronic
1093386293 12:18559408-18559430 AAGGGAAACCACAGGTACTCTGG + Intronic
1094771252 12:33662762-33662784 CAGTGAATCCAGAGGGAAGCAGG + Intergenic
1096863814 12:54549533-54549555 GAGGGAGAGCAGAGGGAGGGGGG + Exonic
1097009337 12:55941125-55941147 GAGGGAAACAGGAGGGAGGGGGG + Intronic
1097241784 12:57580628-57580650 GGGGGAAACCAGATGGAGACAGG + Intronic
1097288172 12:57893538-57893560 GACGGAGACCAGAGTGAGGCTGG + Intergenic
1098416745 12:70243362-70243384 GAGGGAAGCCGGAGCGACGGGGG + Exonic
1101431511 12:104631412-104631434 GAGGGAAAGCACATAGACGCTGG - Intronic
1101939452 12:109089234-109089256 GAGGGAGAGCAGAGGGACTCTGG - Intronic
1102505388 12:113381278-113381300 GAGGAAAGCAAGAGGGAGGCAGG - Intronic
1103018276 12:117513099-117513121 GAGGGAAACGAGATGGAGGGAGG - Intronic
1103318765 12:120077951-120077973 GAGGGAAACCAGAGGGACGCAGG - Intronic
1104899782 12:132182590-132182612 GAGGAACACCAGGGGGACACAGG - Intergenic
1106029889 13:25990521-25990543 GTGGGAAACCAGAGTGATCCAGG + Intronic
1106704506 13:32266374-32266396 CAAGGAAACCAGAGATACGCAGG - Intronic
1107709879 13:43141223-43141245 GAGGGAACCCAAATGGAAGCAGG + Intergenic
1107832976 13:44390736-44390758 GAGGGAAAAAAGAGAGATGCCGG - Intronic
1111854825 13:93624531-93624553 GAGGAAAACCACAAGGATGCTGG - Intronic
1113709920 13:112456450-112456472 GAAAGAAACCAGAGGCAGGCAGG + Intergenic
1113773965 13:112931816-112931838 GGGGCAGGCCAGAGGGACGCAGG + Intronic
1114484964 14:23056931-23056953 GGGGGAAACCGGAGGAAGGCTGG + Intronic
1114524409 14:23359267-23359289 GAGGGACCCCAGAGGGACCAAGG - Intronic
1118482323 14:66179718-66179740 GAGGGAAATTAGAGGGGTGCTGG - Intergenic
1121445340 14:93975165-93975187 GAGGGGGCTCAGAGGGACGCAGG - Intronic
1121793395 14:96716080-96716102 GAGGGGAACCTTGGGGACGCAGG - Intergenic
1122413814 14:101539103-101539125 GAGGGATCCCAGAGGGGCCCGGG - Intergenic
1122419145 14:101564338-101564360 GAGGGCGACCCGGGGGACGCGGG + Intergenic
1202872475 14_GL000225v1_random:177382-177404 CAGGGCAACCGTAGGGACGCCGG - Intergenic
1124608756 15:31193266-31193288 GAGGGAAAGCAGATGGAAGAGGG - Intergenic
1127904416 15:63365728-63365750 AAGGGAGACCAGAGGGATGTAGG - Intronic
1128532615 15:68464912-68464934 GAGAGAGGCCAGAGGGAGGCTGG - Intergenic
1129097572 15:73225331-73225353 GAGAGGAACCAGAGGTGCGCGGG + Intronic
1129325858 15:74800019-74800041 GAGTGAATACAGAGGGACACGGG - Intronic
1129718388 15:77864832-77864854 GAGGGAAACATGAGAGAGGCAGG + Intergenic
1130460535 15:84156033-84156055 GAGGGAAACATGAGAGAGGCAGG - Intergenic
1130746837 15:86663411-86663433 GAGAGAAACCATAGAGACCCAGG + Intronic
1131412747 15:92224184-92224206 TAGGGAAAACAGAGGTACACAGG + Intergenic
1132162537 15:99556326-99556348 GAGAGAAAGCAGGGGGACTCAGG + Intergenic
1132169176 15:99629998-99630020 GAGGGAGAAGAGAGGGACGGGGG - Intronic
1132185301 15:99798192-99798214 GAGAGAAAGCAGAGAGAAGCAGG + Intergenic
1132431686 15:101766370-101766392 GAGAGAAAGCAGAGAGAAGCAGG - Intergenic
1132932308 16:2464890-2464912 GAGAGAAAACAGAGGGAGCCAGG - Exonic
1132981690 16:2741446-2741468 GGGGGAAACCTCAGGGACTCAGG + Intergenic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1137819018 16:51425809-51425831 AAGGGAAACCAAAACGACGCAGG - Intergenic
1139391301 16:66607665-66607687 GAGGGAAATCAAAGCGAGGCAGG - Intronic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140635004 16:76902088-76902110 GAGAGAACCCTGAGGGACACTGG + Intergenic
1140772964 16:78222962-78222984 GAGGGGAGCCAGAGGAATGCAGG + Intronic
1141746482 16:85929791-85929813 GCGGGAGACCAGAGGGAGGGAGG + Intergenic
1141766870 16:86064610-86064632 GAGGGAAACCTGAAGGAGGGGGG - Intergenic
1142046724 16:87930278-87930300 GTGGGAAAGCAGAGGGCCGGGGG + Intronic
1142282673 16:89156737-89156759 GAGGGAAGGCAGAGGGCGGCAGG - Intergenic
1142616540 17:1139720-1139742 GTGGGAAACCAGATGGACACAGG + Intronic
1142905787 17:3040958-3040980 CAGGGAAACCAGAGAGAGCCAGG - Intergenic
1143963219 17:10737796-10737818 GAGGGAAACCGGAGGGGCTCAGG - Intergenic
1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG + Intronic
1145049387 17:19648056-19648078 GGGGGAAACCTGAGGGCAGCGGG + Intergenic
1146382651 17:32342240-32342262 CGGGGAAACCAGCGGAACGCAGG - Intronic
1147187243 17:38719623-38719645 GAGGGACACCCGAGGGAGGAGGG + Intronic
1147312464 17:39603651-39603673 GAGGCCAAACAGAGGGACCCTGG - Intronic
1147418665 17:40311223-40311245 GAGGGAAGCCAGTGGGAGGATGG + Intronic
1147549185 17:41426675-41426697 GAGGGAAACCAGAAGGACCATGG + Intergenic
1147664897 17:42140421-42140443 GTGGGAGACCTGAGGGACGATGG + Intronic
1147675378 17:42201870-42201892 GAGGGAAAGAAGAGGGATGAAGG + Intronic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1150200394 17:63350296-63350318 GGGGGAAAGCAGAGGGAAGAGGG - Intronic
1151796772 17:76351859-76351881 GAGGGAGAGCAGAGGGGAGCAGG - Intronic
1152806562 17:82359617-82359639 GAGGGAAACTTGAGGGAAACTGG - Intronic
1152806630 17:82359862-82359884 GAGGGAAACTTGAGGGAAACTGG - Intronic
1152806695 17:82360065-82360087 GAGGGAAACTTGAGGGAAACTGG - Intronic
1152806743 17:82360217-82360239 GAGGGAAACTTGAGGGAAACTGG - Intronic
1152806791 17:82360368-82360390 GAGGGAAACTTGAGGGAAACTGG - Intronic
1152806845 17:82360550-82360572 GAGGGAAACTTGAGGGAAACTGG - Intronic
1152806910 17:82360763-82360785 GAGGGAAACTTGAGGGAAACTGG - Intronic
1152806951 17:82360894-82360916 GAGGGAAACTTGAGGGAAACTGG - Intronic
1152807046 17:82361235-82361257 GAGGGAAACTTGAGGGAAACTGG - Intronic
1153796178 18:8624166-8624188 AAGGGAAACAAAAGGGATGCTGG - Intronic
1154132733 18:11750867-11750889 GAGGGAAACCAGCCGGTAGCAGG + Intronic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1160219235 18:76960503-76960525 TAGGGAGACCAGAGGGAGCCTGG - Intronic
1160814368 19:1028426-1028448 GCGGGAAGCCAGGGGGAAGCTGG - Intronic
1160875454 19:1294491-1294513 GAGGGAGACCAGGAGGCCGCCGG + Intronic
1161176743 19:2847892-2847914 GAGGTAAACCAAGGGGAAGCAGG + Intronic
1163004756 19:14390120-14390142 GAGGGAAAGAAGAGGGAGGGAGG + Intronic
1163350974 19:16776993-16777015 GAGGGAAAGGAGAGGGAAGAGGG + Intronic
1164615195 19:29663482-29663504 GGGGGAAACCAGAGGGAGTGTGG + Intergenic
1166636132 19:44453095-44453117 GGGGGAAACCAGAGAGTCTCTGG + Intergenic
1168713826 19:58516012-58516034 GCTGGAAACCAGAGAGACACAGG + Intronic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
927553530 2:24017776-24017798 GAAGGAACCCAGAAGGAGGCAGG - Intronic
929441834 2:41971034-41971056 GAGGGAAGCCAGTGGGAAGTGGG + Intergenic
929564561 2:42976446-42976468 GAGGGAAACCTGAGGGGCCCAGG + Intergenic
929942862 2:46348068-46348090 GAGGGAATCCAGTGTGAGGCTGG + Intronic
930975001 2:57446791-57446813 GAGGGAAAGCAGAGGAAAGAGGG + Intergenic
933764100 2:85695450-85695472 GAGGGAAAGGAGAGGGACTGTGG - Intronic
934460285 2:94210913-94210935 GAGGCAAGCCAGTGGGCCGCAGG - Intergenic
934692022 2:96368969-96368991 TAGGCAAACCACAGGGAAGCTGG + Exonic
935358456 2:102226694-102226716 GAGGGAAAACGGAGGGAAGAAGG + Intronic
935745876 2:106189892-106189914 GAGTGAAACAAGAGGGAGTCAGG + Intronic
936075645 2:109399980-109400002 CAGGGCAGCCAGAGGGACTCTGG - Intronic
936856672 2:116966633-116966655 GAGGCCAACCATAGGGACTCAGG + Intergenic
937295233 2:120806278-120806300 CAGGGAACCCAGAGGCACCCAGG - Intronic
939696915 2:145337648-145337670 GAGGGAAAACAGAGGGGACCTGG - Intergenic
947041356 2:225924656-225924678 GAGGGAAATCAGAGATAAGCAGG - Intergenic
947571574 2:231239874-231239896 GAGGGACACCTGAGGCACGCTGG - Intronic
948174760 2:235934410-235934432 GACGCGAACCAGAGGGACGCCGG - Intronic
948280439 2:236743193-236743215 GAGGGAAGCAAGAGAGACACAGG + Intergenic
948400074 2:237677820-237677842 GGGGGAAGGCAGAGGGACCCAGG - Intronic
948935139 2:241158986-241159008 GCGGGAACCCAAAGGGAGGCAGG - Intronic
1169660996 20:7978232-7978254 GAGAGAAAGAAGAGGGAGGCTGG - Exonic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1170907517 20:20529072-20529094 CACGGAAACTAGAGGGAGGCAGG + Intronic
1171370883 20:24661358-24661380 GAGGGAAAACCGAGGGAAGAGGG + Intronic
1172116212 20:32574942-32574964 GAGGGAGGCTAGAGGGTCGCAGG - Intronic
1173973912 20:47173051-47173073 GTGGGAAAGCTGAGGGACGGAGG + Intronic
1175294679 20:57900241-57900263 GAGGGAAACGAGTGGGAGGAAGG - Intergenic
1175387358 20:58605862-58605884 GAGGGAAGCCAGAGTGAGCCCGG - Intergenic
1175624793 20:60481379-60481401 CAGGGAATGCAGAGGGACCCTGG - Intergenic
1175966341 20:62661860-62661882 GAGGGACAACAGAGGGGCCCGGG + Intronic
1176591410 21:8653951-8653973 GAGGCAAGCCAGTGGGCCGCAGG - Intergenic
1178413787 21:32387443-32387465 GAGTGGAACCAGAGAGAGGCAGG - Intronic
1178808588 21:35860169-35860191 GAGGGAAAAGAGAGGGAGGGAGG + Intronic
1178936970 21:36871448-36871470 GAAGGAAAACAAAGGGACACAGG + Intronic
1179664861 21:42904065-42904087 AAAGGAAACCTCAGGGACGCAGG + Exonic
1180258550 21:46650795-46650817 GAGGGACACAGGAGGGACGTGGG + Intronic
1180274258 22:10631062-10631084 GAGGCAAGCCAGTGGGCCGCAGG - Intergenic
1181355964 22:22295843-22295865 GAGGCAAGCCAGTGGGCCGCAGG + Intergenic
1181527342 22:23497569-23497591 GAGGGCATCCAGAGGGAGGAGGG - Intergenic
1182282281 22:29224538-29224560 AATGAAAACCAGAGGGAGGCTGG - Intronic
1182462457 22:30492172-30492194 GAGGGACTCCAAAGGGACTCAGG + Intronic
1182467425 22:30525949-30525971 GAGGGACTCCAAAGGGACTCAGG + Intronic
1184003798 22:41694334-41694356 AATAGAAACCAGAGGGAGGCTGG + Exonic
1184004003 22:41695775-41695797 GAGAGAAACCAGAGAGAACCTGG + Exonic
1184518548 22:44978653-44978675 GATGAAAACCACAGGGAGGCTGG - Intronic
1184976455 22:48065885-48065907 GAGGGAATATAGAGGGAAGCTGG + Intergenic
1185012257 22:48320850-48320872 GAGGGAAACCCCAGGGGCCCAGG + Intergenic
1185190269 22:49431799-49431821 AAGGGAAACCACAGAGACACAGG - Intronic
950319763 3:12040363-12040385 GATGGAAGCCAGAGTGAGGCAGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
953391954 3:42539120-42539142 GAGGGAAACCAGAGAGAGAGAGG - Intergenic
953750836 3:45607267-45607289 CAGGGAAACCAGCTGGACACAGG + Intronic
953789960 3:45939719-45939741 GAGGCTGACCAGAGGGACGATGG - Intronic
954363665 3:50135229-50135251 GAGAGAGACCAGAAGGGCGCAGG + Intergenic
954652435 3:52173353-52173375 GAGGCAAAACAGAAGGATGCAGG + Intergenic
955308319 3:57857549-57857571 AAGGGAAACCAGAGATAAGCGGG + Intronic
955400936 3:58591173-58591195 GAAGGAGAACAGAGAGACGCTGG + Intronic
956066121 3:65399261-65399283 GAGGGAATTCACAGGGAAGCTGG - Intronic
956529465 3:70201764-70201786 GAGGGAATGGAGAGGGAAGCAGG - Intergenic
962384487 3:134921885-134921907 GAGGGAGGGCAGAGGGACGGGGG + Intronic
962454246 3:135550493-135550515 GAGGGAAGCAAGAGGCAGGCAGG + Intergenic
963741480 3:149086223-149086245 CAGGGAACGCAGAGGAACGCGGG + Intronic
964406174 3:156351806-156351828 GAGAGAGACCAGAGGAAGGCAGG - Intronic
967150140 3:186640750-186640772 GAGGGAACCCAGAGACACCCTGG + Intronic
974499247 4:62677506-62677528 GAGAGAAACAAGAGGGAGGCTGG - Intergenic
984401495 4:179271421-179271443 AAGGGAAAAGAGAGGGAGGCAGG - Intergenic
984864787 4:184272195-184272217 GAGGGAAGCCAGAGGGTTGAGGG - Intergenic
985079981 4:186254881-186254903 GAGGGAAACGTGAGGGTTGCTGG + Intronic
987432166 5:17848091-17848113 GAGGGAAAAGAGAGTGAGGCAGG + Intergenic
988710972 5:33774289-33774311 GAGGGGAACCTGAGGGTCCCAGG + Intronic
988810781 5:34783213-34783235 GAAGAAAACCAGAGGAAAGCGGG - Intronic
989236724 5:39156426-39156448 CAGCAAAACCAGAGGGAAGCAGG + Intronic
989408269 5:41086725-41086747 AAGAGAAACCAGAAGGAGGCTGG - Intergenic
990109820 5:52309118-52309140 GAAGGAAACCTGAGGAAAGCAGG + Intergenic
990333222 5:54747592-54747614 GAGGAAAACCAGGAGAACGCTGG - Intergenic
994341177 5:98630091-98630113 GAGGGACTACAGAGGGACACGGG + Intergenic
994883648 5:105529672-105529694 GAGGGCAGCCAGAGGCACGGGGG - Intergenic
996010676 5:118478751-118478773 GAGGGCAACCAGAGGAGCACGGG + Intergenic
998424263 5:142013271-142013293 GAGGGAGACTTGAGGGGCGCCGG + Intergenic
998794131 5:145799555-145799577 GAGGAAAACCACAAGGACCCAGG + Intronic
1001649165 5:173303061-173303083 GAGGAAAACAAGAGGGAAGGAGG - Intergenic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1003024461 6:2541941-2541963 GAGGCAAACCAGAGGGAGATGGG + Intergenic
1003528258 6:6916540-6916562 GAAGGAAAGCAGAAGGAGGCAGG + Intergenic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1005802473 6:29440818-29440840 GAGGGACACCAGAGGGTCAGTGG - Exonic
1006341282 6:33448546-33448568 GAGGGAGGCCAGAGGGAGGCTGG - Intronic
1008376997 6:50803120-50803142 GAGGGAAAACAGAGAGGCACAGG - Intergenic
1008627843 6:53335332-53335354 CAGGGAAGCCAGAGGGAGACAGG - Intronic
1009442639 6:63699883-63699905 GAAAGAAACCTGAGGGAGGCCGG - Intronic
1011292990 6:85795798-85795820 GAGGGAATGGAGAGGGAAGCAGG + Intergenic
1011686825 6:89830152-89830174 GAAGGACCACAGAGGGACGCAGG - Intronic
1012553080 6:100482016-100482038 CAGGGACTCCAGAGGGAAGCGGG + Intergenic
1016040943 6:139431537-139431559 GAGGGGATCCAGAGGGATGGGGG - Intergenic
1016625159 6:146158279-146158301 GAAGGAAACAAGAGGGAGGATGG + Intronic
1017240406 6:152162019-152162041 AAAGCAAACCAGAGGGACTCTGG - Intronic
1017646075 6:156541029-156541051 GAGGGAATTCAGAGGGAAGAGGG + Intergenic
1018048457 6:159986109-159986131 GAAGGAAACCAGCGGGACACAGG - Intronic
1019361399 7:605987-606009 GAGGGAAACAAGGGTGATGCTGG - Intronic
1019762498 7:2824186-2824208 GAGGGAGACCAGGTGGACGTGGG - Intronic
1019763212 7:2829766-2829788 GAGGGCTACCACAGGGATGCTGG - Intronic
1021985519 7:26094625-26094647 GATGGAAACGAGAGGGAGGTTGG - Intergenic
1026822079 7:73556855-73556877 CAGGGAAATTAGAGGGAGGCTGG + Intronic
1030942476 7:115671222-115671244 AAGGGAAACCAGGGGCACGTGGG - Intergenic
1032458387 7:132091602-132091624 GTGGGGAACAAGAGGCACGCTGG - Intergenic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1032658993 7:133962519-133962541 GAAGGGAACCAGAGGGTCGAAGG - Intronic
1035614036 8:989229-989251 CTGGGAACCCAGAGGGACTCCGG - Intergenic
1037821285 8:22136009-22136031 GAACAAAACCAGAGGGGCGCCGG - Intergenic
1038053687 8:23837677-23837699 GAGGGGAAGCAGAGGGGAGCAGG + Intergenic
1039407544 8:37326286-37326308 GAGGGAAGCCAGTGGGAGGAAGG - Intergenic
1039774080 8:40718645-40718667 GAGGGAAAGAAGAAGGAGGCTGG - Intronic
1040329949 8:46380809-46380831 GAGGGAGATCACAGGGACTCAGG + Intergenic
1040456600 8:47604493-47604515 TAGTGAAAGCAGAGAGACGCAGG + Intronic
1040643756 8:49372746-49372768 GAGAGAAAGCAGAGGGACATTGG + Intergenic
1043528639 8:81124772-81124794 TAGGGAAACCAGAGGCCCCCTGG - Intergenic
1043581329 8:81719600-81719622 GATGCAAACCAGAAGGACCCAGG + Intronic
1045501756 8:102749015-102749037 CAGGGATCCCAGAGGGAAGCAGG + Intergenic
1047366716 8:124217810-124217832 GAGGGAGGCAAGAGGGACACTGG + Intergenic
1047961253 8:130013681-130013703 GAAGGACGCCCGAGGGACGCGGG - Intronic
1048115486 8:131517197-131517219 GAGGGTAAGCAGAAGGATGCAGG - Intergenic
1049145718 8:141000480-141000502 GAGGGAAATCGCAGGGACGTCGG - Intronic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1053690784 9:40586610-40586632 GAGGCAAGCCAGTGGGCCGCAGG - Intergenic
1054274020 9:63050881-63050903 GAGGCAAGCCAGTGGGCCGCAGG + Intergenic
1054400820 9:64714087-64714109 GAGGCAAGCCAGTGGGCCGCAGG - Intergenic
1054434427 9:65198401-65198423 GAGGCAAGCCAGTGGGCCGCAGG - Intergenic
1054495963 9:65823280-65823302 GAGGCAAGCCAGTGGGCCGCAGG + Intergenic
1054941980 9:70753543-70753565 GAGGGAACCCAGATGGGAGCAGG + Intronic
1055164260 9:73172291-73172313 GTGGGAAATCAGAGGGAACCTGG + Intergenic
1058777321 9:108297111-108297133 TATGGAAACCAGATGGAAGCTGG - Intergenic
1060529071 9:124337329-124337351 GAGGGAAGCCAGAGGGCTTCAGG - Intronic
1061839806 9:133352030-133352052 GGAGGAAGCCAGAGGGCCGCTGG + Intronic
1061855356 9:133439115-133439137 GGGGCAAGCCAGAGGGAGGCAGG - Intronic
1062182032 9:135196056-135196078 GCGGGAAACCAGGGTGACGAAGG + Intergenic
1062328609 9:136025178-136025200 GAGGCAAACCAGAAGCACACCGG + Intronic
1203621438 Un_KI270749v1:132715-132737 GAGGCAAGCCAGTGGGCCGCAGG - Intergenic
1185872213 X:3673668-3673690 GAGGGAAAGGAGAGACACGCAGG + Intronic
1186361963 X:8851782-8851804 TCAGGAAACCAGAGGGAGGCCGG + Intergenic
1188270055 X:28128019-28128041 AATGGAAACCAGAGGAACCCAGG - Intergenic
1189089881 X:38070509-38070531 GAGAGAAACCAGAGGTAGGCAGG - Intronic
1189225169 X:39406747-39406769 GAGGGATACATGAGGGAAGCAGG - Intergenic
1190109768 X:47582461-47582483 GAGAGACACCAGAGGTAAGCAGG + Exonic
1195731829 X:107976246-107976268 GAGGGAAATGAGAGGGAGGGAGG + Intergenic
1198499931 X:137233749-137233771 GAGGGAAATCAGGGGAAGGCAGG - Intergenic
1201700650 Y:16877910-16877932 GAAGAAAACCTGAGGGAAGCAGG + Intergenic
1202378715 Y:24259147-24259169 GAGGGAAACATGAGAGAGGCAGG + Intergenic
1202492067 Y:25410974-25410996 GAGGGAAACATGAGAGAGGCAGG - Intergenic