ID: 1103320005

View in Genome Browser
Species Human (GRCh38)
Location 12:120086970-120086992
Sequence CTACAGCCGCGGCGCAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 57}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103320005_1103320017 27 Left 1103320005 12:120086970-120086992 CCGGCGCTGCGCCGCGGCTGTAG 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1103320017 12:120087020-120087042 AACGTTAGTCAGCACATTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 56
1103320005_1103320018 28 Left 1103320005 12:120086970-120086992 CCGGCGCTGCGCCGCGGCTGTAG 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1103320018 12:120087021-120087043 ACGTTAGTCAGCACATTCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1103320005_1103320019 29 Left 1103320005 12:120086970-120086992 CCGGCGCTGCGCCGCGGCTGTAG 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1103320019 12:120087022-120087044 CGTTAGTCAGCACATTCCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1103320005_1103320011 3 Left 1103320005 12:120086970-120086992 CCGGCGCTGCGCCGCGGCTGTAG 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1103320011 12:120086996-120087018 TGGGCCCATCTGTCCCTCGCCGG 0: 1
1: 0
2: 1
3: 14
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103320005 Original CRISPR CTACAGCCGCGGCGCAGCGC CGG (reversed) Intronic
1073210130 10:101793686-101793708 CTAGAGCCGCTGCGCTTCGCAGG + Intronic
1076658194 10:132037866-132037888 CTACAGCCCCAGAGCAGCCCTGG - Intergenic
1083266618 11:61549961-61549983 TTACAGCCGCGGGCCAGGGCTGG - Intronic
1094051674 12:26226999-26227021 CTCCGCCCGCTGCGCAGCGCCGG + Intronic
1102259333 12:111434911-111434933 CTCCAGCCACGGCACAGCACCGG - Intronic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1105443746 13:20435677-20435699 ATACAACGGCAGCGCAGCGCAGG + Intronic
1113656165 13:112068737-112068759 CAGCGGCCGCGGCGCAGAGCCGG + Exonic
1125175758 15:36819800-36819822 CTTCAGCGGCGGCACAGCACAGG + Intergenic
1129710598 15:77818784-77818806 CTAGGCCCGCGGCGCCGCGCTGG - Intronic
1130305326 15:82709426-82709448 CTGGAGCCCCGGCCCAGCGCGGG - Intronic
1142305122 16:89280437-89280459 CTCCAGCCCCGGCTCAGCGACGG + Exonic
1147400416 17:40177554-40177576 CTGCCGCCGCAGCGCAGAGCCGG + Intronic
1152544114 17:80992177-80992199 CGGCAGCCACGGCGCCGCGCAGG - Intronic
1153688092 18:7566840-7566862 CCGCAGCCGCCGAGCAGCGCAGG + Exonic
1156171764 18:34494069-34494091 CTGCTGCCGCGGCGCCGCTCGGG + Intronic
1159586899 18:70289723-70289745 CTTCAGCCGCAGAGCAGCCCCGG - Intronic
1161397884 19:4054398-4054420 CTACGGCCGCGGCGGAGAGGAGG - Exonic
1165204522 19:34172460-34172482 CTCAAGCCGCGGCGCGGCGGCGG - Intergenic
1165307662 19:35012206-35012228 CTACAGCCGGGGGGCAGAGGGGG - Intronic
927679655 2:25131418-25131440 CAACAGCCGCAGCGCTGCGACGG + Exonic
934686842 2:96327397-96327419 CCACAGCGGCGGCCCAGGGCTGG - Exonic
942491153 2:176490698-176490720 CCACAGCAGCCGCCCAGCGCAGG + Intergenic
943185167 2:184598315-184598337 CTGCGGCAGCGGCGCCGCGCGGG + Intergenic
944172976 2:196799736-196799758 CTGCAGCTGCGGCGCAGACCGGG - Intergenic
946865645 2:224039250-224039272 CTGCAGACGCCGCGCAGCCCGGG + Intronic
1168887005 20:1266793-1266815 CACCTGCCGCGGTGCAGCGCAGG - Intronic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1171533252 20:25865933-25865955 ATCCAGCCGCTGCGCAGCGGTGG - Intronic
1172528543 20:35615913-35615935 CTTCAGCCGCTGCGCGCCGCGGG - Exonic
1176069086 20:63216668-63216690 CTTCAGCCGCAGCGGAGCCCTGG + Intergenic
1183585925 22:38752848-38752870 CTCCAGCCGCTGCACAGTGCAGG - Intronic
1184276576 22:43412244-43412266 CGACGCCCGCGGCGCTGCGCAGG + Intronic
1185385634 22:50530274-50530296 GTTCGGACGCGGCGCAGCGCTGG + Intronic
955365570 3:58307078-58307100 CTAGAGCCGAGGCCCAGCGGTGG + Intronic
956468548 3:69542224-69542246 CTACAGCCCCGGAGCGCCGCAGG - Intronic
968230358 3:197002111-197002133 CTACAGCCGGGGCGCTGCCAGGG + Exonic
968372829 4:11298-11320 CTCCCGCCCCGGCGCCGCGCCGG - Intergenic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
975710589 4:77157285-77157307 CCTCCGCCGCGGCGCAACGCCGG - Exonic
982214501 4:153069022-153069044 CTCCAGCCACGTGGCAGCGCTGG + Intergenic
982489110 4:156006407-156006429 CCACAGAGGCTGCGCAGCGCTGG - Intergenic
983060409 4:163153264-163153286 CTGCAGCCCCGGTGCAGTGCGGG + Intronic
984811406 4:183798403-183798425 CTCCAGCCGCGGAGCAGTGCCGG - Intergenic
992105871 5:73448495-73448517 CGGCAGCCCCGGCGCAGCTCCGG - Intergenic
1004924111 6:20402581-20402603 CTGCCGCCGCGTCCCAGCGCTGG - Exonic
1012554347 6:100493356-100493378 GTATAGCCGCGGGGCAGAGCCGG + Intergenic
1016272249 6:142302207-142302229 GTCCCGCCGCGGCGCAGGGCTGG + Exonic
1018635088 6:165854134-165854156 CCACGGGCGCAGCGCAGCGCTGG + Intronic
1030262484 7:107580257-107580279 CGGCGGCCGCGGAGCAGCGCAGG + Intronic
1035082051 7:156224450-156224472 CTACAGCCTTGGCACAGGGCTGG - Intergenic
1035752000 8:2002716-2002738 CGGCAGCCGCGGCGAGGCGCAGG + Exonic
1037290781 8:17347485-17347507 CTACAGCCGGGGGGTAGAGCAGG - Intronic
1043502808 8:80873845-80873867 CCGCCGCCGCCGCGCAGCGCCGG - Intronic
1045277739 8:100722349-100722371 CCACGGACGCGACGCAGCGCGGG - Exonic
1061089957 9:128420888-128420910 CTGGAGCAGCGGCGCGGCGCGGG - Exonic
1062037057 9:134387052-134387074 CCACAGCAGCGGCCCAGGGCAGG - Intronic
1195668349 X:107449915-107449937 CGGCAGCGGCGGCGCAGCGGCGG - Intergenic
1197749951 X:129957403-129957425 CTGTCGCCGCGGCGCAGGGCCGG - Intergenic